si:dkey-189g17.3

Ensembl ID:
ENSDARG00000062696
ZFIN ID:
ZDB-GENE-081105-39
Description:
Novel protein similar to vertebrate diacylglycerol kinase, beta 90kDa (DGKB) [Source:UniProtKB/TrEMB
Human Orthologue:
DGKG
Human Description:
diacylglycerol kinase, gamma 90kDa [Source:HGNC Symbol;Acc:2853]
Mouse Orthologue:
Dgkg
Mouse Description:
diacylglycerol kinase, gamma Gene [Source:MGI Symbol;Acc:MGI:105060]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17269 Nonsense Available for shipment Available now
sa788 Nonsense Available for shipment Available now
sa16216 Nonsense Available for shipment Available now
sa34624 Nonsense Mutation detected in F1 DNA During 2017
sa41406 Nonsense Mutation detected in F1 DNA During 2017
sa34625 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16348 Essential Splice Site Available for shipment Available now
sa8586 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 238 865 6 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Nonsense 55 682 2 20
Genomic Location (Zv9):
Chromosome 9 (position 23520613)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22676399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGTCTTAWCTTTTGTTTCTTTCACCCTGAAGTCATGTTCAGGCTGTA[C/A]GACACAGATGGCAACGGTCTGCTGGACAGTTCGGTAAGTCCTAYATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 348 865 9 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Nonsense 165 682 5 20
Genomic Location (Zv9):
Chromosome 9 (position 23524405)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22680191
KASP Assay ID:
554-0693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAGCCTACTGTAATTACTGCCACACCATGTTGTTAGGAGTACGAAAG[C/T]AGGGTCTTTGCTGCGCACGTGAGTATCTGTGTGTCTGTTTTTCTATAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 407 865 11 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Nonsense 224 682 7 20
Genomic Location (Zv9):
Chromosome 9 (position 23527046)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22682832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCAACTCCTCAGCAAAATGTGACAAATGTCACCGCAGTATCAAGTG[C/A]TATCAAGGTCTGACAGGCCTTCACTGTGTTTGGTGTCAAATCACTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 488 865 13 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Nonsense 305 682 9 20
Genomic Location (Zv9):
Chromosome 9 (position 23530618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22686404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCAGTCCTGAGGACACCGGCCAGTGTTTCAAGTTCACCGGTGATGGA[C/T]AGGCGCTGCAAGTGAGCCCCTAGAAGACTAAAAATATCTGTATAACAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Nonsense 608 865 18 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Nonsense 425 682 14 20
Genomic Location (Zv9):
Chromosome 9 (position 23556106)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22711892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCATGTCTGTGTTGTGATTGACAGGTTATGAAGGAGGAAGTCTGGTC[A/T]AGTTCCTCAGGGATATCGAGCACAGCACTGAGGTTCTTCTTGACCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 675 865 19 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Essential Splice Site 492 682 15 20
Genomic Location (Zv9):
Chromosome 9 (position 23581638)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22737424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCTTCCATCTGATGAGAGAAAAACATCCTGAGAAGTTCAACAGCAG[G/A]TAAGAGAAGATGCATATTTATAAATCAACATATGCAGAAAAGGCAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 675 865 19 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Essential Splice Site 492 682 15 20
Genomic Location (Zv9):
Chromosome 9 (position 23581639)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22737425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCTTCCATCTGATGAGAGAAAAACATCCWGAGAAGTTCAACAGCAGG[T/G]AAGRGAAGAKGCATATTTATAAATCAACATATGSAGAAAAGGCAAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090907 Essential Splice Site 705 865 20 24
ENSDART00000131214   None 84 None 3
ENSDART00000146028 Essential Splice Site 522 682 16 20
Genomic Location (Zv9):
Chromosome 9 (position 23611688)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22767474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATTTCAGCCACTTGTAAAAAGCTGAACGAAACTATTGAAGTGGAGG[T/G]GAGTTCGGGACATTCAGCCTATCAAKAGTGGCCTGTTTTAGCTTACAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link