ccdc126

Ensembl ID:
ENSDARG00000062695
ZFIN ID:
ZDB-GENE-060503-11
Description:
coiled-coil domain-containing protein 126 [Source:RefSeq peptide;Acc:NP_001038868]
Human Orthologue:
CCDC126
Human Description:
coiled-coil domain containing 126 [Source:HGNC Symbol;Acc:22398]
Mouse Orthologue:
Ccdc126
Mouse Description:
coiled-coil domain containing 126 Gene [Source:MGI Symbol;Acc:MGI:1889376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43261 Nonsense Mutation detected in F1 DNA During 2017
sa36822 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090942 Nonsense 56 166 2 3
ENSDART00000134650 Nonsense 34 144 3 4
Genomic Location (Zv9):
Chromosome 19 (position 20656223)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20589603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCAGTGCAGAGCTCCGTCAACAGATCCTTGAGCTCAGCCATCGCTA[T/A]GTCAAAGTCCTTAGTGAGGAAAACCAGAACCCCTCGGGACCCCATGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090942 Splice Site, Nonsense 78 166 2 3
ENSDART00000134650 Splice Site, Nonsense 56 144 3 4
Genomic Location (Zv9):
Chromosome 19 (position 20656289)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20589669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAAACCAGAACCCCTCGGGACCCCATGGCACCTCAATGGCAGGATA[T/G]GGTAAGGATTGGATTACCATCATGTGGTTACAAACTTGAATTCCATTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link