nrxn3b

Ensembl ID:
ENSDARG00000062693
ZFIN IDs:
ZDB-GENE-070206-10, ZDB-GENE-070206-10, ZDB-GENE-070206-10
Description:
neurexin 3b [Source:RefSeq peptide;Acc:NP_001073516]
Human Orthologue:
NRXN3
Human Description:
neurexin 3 [Source:HGNC Symbol;Acc:8010]
Mouse Orthologue:
Nrxn3
Mouse Description:
neurexin III Gene [Source:MGI Symbol;Acc:MGI:1096389]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36960 Nonsense Mutation detected in F1 DNA During 2017
sa43379 Nonsense Mutation detected in F1 DNA During 2017
sa12447 Nonsense Available for shipment Available now
sa7476 Missense Mutation detected in F1 DNA During 2017
sa15937 Essential Splice Site Available for shipment Available now
sa11015 Nonsense Available for shipment Available now
sa19226 Nonsense Mutation detected in F1 DNA During 2017
sa16685 Nonsense Available for shipment Available now
sa44933 Nonsense Mutation detected in F1 DNA During 2017
sa32273 Nonsense Available for shipment Available now
sa36961 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 135 1407 1 22
ENSDART00000090934 Nonsense 135 1404 1 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 135 1687 1 23
Genomic Location (Zv9):
Chromosome 20 (position 5596348)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5520047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGCGTTGGACGGAGATTCTAAGGTGGATGAGGTGAGACCACAAAGG[C/T]AGTTCATGAAAATTGTCAGTGACCTGTATCTTGGAGGTGTCCCTCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 301 1407 4 22
ENSDART00000090934 Nonsense 301 1404 4 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 301 1687 4 23
Genomic Location (Zv9):
Chromosome 20 (position 5705940)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5629639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGGCAACGCAATGGTCTGATCCTCCACACGGGCAAATCGGCTGACTA[T/A]GTTAACCTGGCATTGAAGGATGGCGCCGTTTCATTGGTCATCAACCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 363 1407 5 22
ENSDART00000090934 Nonsense 363 1404 5 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 363 1687 5 23
Genomic Location (Zv9):
Chromosome 20 (position 5710324)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5634023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGAAAGCACTCAGGCATTGGACACGCTATGGTAAAMAAACTACATTG[T/A]CTGGTAGATATCATTCTTATTGTCCTTTTTTGGTTTGCCGTGTGTCYCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Missense 709 1407 9 22
ENSDART00000090934 Missense 708 1404 9 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Missense 708 1687 9 23
Genomic Location (Zv9):
Chromosome 20 (position 5761567)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5685176
KASP Assay ID:
554-4278.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAACAGAGGCATCAATCCTAAGCTATGATGGCAGCATGTACATGAAG[G/A]TGGTGATGCCGACGATCATACATACAGAAGCAGAGGACGTGTCTCTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Essential Splice Site 802 1407 10 22
ENSDART00000090934 Essential Splice Site 801 1404 10 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Essential Splice Site 801 1687 10 23
Genomic Location (Zv9):
Chromosome 20 (position 5770590)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5694199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGCGTGGTAAAAACATCAAACTTATGGTGGATGATGATGTAGCTGAAG[G/A]TATGCATGCMGCATAGTCTTTACAAAACAAATCAGTAYCWGCCCTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 880 1407 11 22
ENSDART00000090934 Nonsense 879 1404 11 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 879 1687 11 23
ENSDART00000090646 Nonsense 880 1407 11 22
ENSDART00000090934 Nonsense 879 1404 11 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 879 1687 11 23
Genomic Location (Zv9):
Chromosome 20 (position 5770918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5694527
KASP Assay ID:
2261-3937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATGCTCGTTTTGGGATGCGCTCCATCGTGGCTGACCCTGTTACMTTC[A/T]AGACTAAAGGAAGCTATCTGGGACTTGCTACACTCCAGGCGTATAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 880 1407 11 22
ENSDART00000090934 Nonsense 879 1404 11 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 879 1687 11 23
ENSDART00000090646 Nonsense 880 1407 11 22
ENSDART00000090934 Nonsense 879 1404 11 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050 Nonsense 879 1687 11 23
Genomic Location (Zv9):
Chromosome 20 (position 5770918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5694527
KASP Assay ID:
2261-3937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGCTCGTTTTGGGATGCGCTCCATCGTGGCTGACCCTGTTACCTTC[A/T]AGACTAAAGGAAGCTATCTGGGACTTGCTACACTCCAGGCGTATAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646   None 1407 None 22
ENSDART00000090934   None 1404 None 21
ENSDART00000091877 Nonsense 26 675 1 10
ENSDART00000127050   None 1687 None 23
Genomic Location (Zv9):
Chromosome 20 (position 5854574)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5778183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCCAGTGGCTTTCCWGCATGCTACCCCTGGTCAYAGGGTGCGTGTTC[G/T]GAGCCGTRTGGGGCTCGAACCTTGATAGCACAGTCGTCCTCTCGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 1233 1407 17 22
ENSDART00000090934 Nonsense 1232 1404 17 21
ENSDART00000091877 Nonsense 220 675 4 10
ENSDART00000127050 Nonsense 1232 1687 17 23
Genomic Location (Zv9):
Chromosome 20 (position 5963567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCAAATGGCTAATAAGAAAATCCCGTTCAAATATACCCGGCCGGTC[G/T]AAGATTGGCTACATGAGAAAGGTAACCCTCACAAGACCCTCAGTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Nonsense 1289 1407 18 22
ENSDART00000090934 Nonsense 1288 1404 18 21
ENSDART00000091877 Nonsense 276 675 5 10
ENSDART00000127050 Nonsense 1288 1687 18 23
Genomic Location (Zv9):
Chromosome 20 (position 5964807)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5888416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATGGCCTGAAGGTTCTCAACATGGCTGCCGAAGGTCATGCTAACATC[A/T]AAATAAATGGCAGCGTGAGACTGGTTGGGGATGTACCTACCAGCAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090646 Essential Splice Site 1372 1407 None 22
ENSDART00000090934 Splice Site 1368 1404 21 21
ENSDART00000091877   None 675 None 10
ENSDART00000127050   None 1687 None 23
Genomic Location (Zv9):
Chromosome 20 (position 5989645)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5913254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATGGGGATGTATATGCTCACTTTTGTATATCCCCATCCCTTCCTTAC[A/C]GCCCAAAGCTCTTTTGCCACCCGAACGCTTCGTACCGCCCTTACATGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link