si:ch211-155k24.6

Ensembl ID:
ENSDARG00000062688
ZFIN ID:
ZDB-GENE-060503-106
Human Orthologue:
GPNMB
Human Description:
glycoprotein (transmembrane) nmb [Source:HGNC Symbol;Acc:4462]
Mouse Orthologue:
Gpnmb
Mouse Description:
glycoprotein (transmembrane) nmb Gene [Source:MGI Symbol;Acc:MGI:1934765]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11355 Essential Splice Site Available for shipment Available now
sa30711 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13099 Nonsense Available for shipment Available now
sa13185 Nonsense Available for shipment Available now
sa23503 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Essential Splice Site 116 621 None 12
ENSDART00000144891 Essential Splice Site 55 499 None 11
Genomic Location (Zv9):
Chromosome 19 (position 20750424)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20683804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGGACAGCAATGGCAACCTGGTGTATGATGAACACTGTGATGACGG[T/C]ACGATGGACACCTCAGGTGCTTCATACCACTGTAATCTCTAAACAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Essential Splice Site 228 621 6 12
ENSDART00000144891 Essential Splice Site 167 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744415)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACCATTTACATTATTAGATTTTTATTCCATGTGTTTCTTTCATCT[A/G]GATAAGATTCCACTCTCCGTCAACATTTCCCAGAAGGAAGCAGCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Nonsense 261 621 6 12
ENSDART00000144891 Nonsense 200 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744315)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677695
KASP Assay ID:
2261-3216.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGGACAGRAACATCTTTGTCAGAGGGTCTGATGTTATTTTCAACGTC[C/T]AGCTCCACGACCCCAGTAACTATCTGAAAACWGCTGATGCGGTGGACTWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Nonsense 279 621 6 12
ENSDART00000144891 Nonsense 218 499 6 11
Genomic Location (Zv9):
Chromosome 19 (position 20744260)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20677640
KASP Assay ID:
2261-3215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACGACCCCAGTAACTATCTGAAAACWGCTGATGCGGTGGACTWCATTT[G/A]GGACTTTCGGGAYGGCAACCAGYTGGTGACACACAGCAGCGTGGCAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090883 Missense 603 621 12 12
ENSDART00000144891 Essential Splice Site 481 499 11 11
Genomic Location (Zv9):
Chromosome 19 (position 20734216)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20667596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGGATGCAGAGAGGAATACTGATAGCTGGGGCTTAGGCAAACTTAGA[G/T]CAGTTCTGTTCTCAGTGGATGAGGAAAGAAGCTGTTTATTGACCGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link