KCNH7 (2 of 2)

Ensembl ID:
ENSDARG00000062687
Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Human Orthologue:
KCNH7
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 [Source:HGNC Symbol;Acc:18863]
Mouse Orthologue:
Kcnh7
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 7 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15943 Nonsense Available for shipment Available now
sa7578 Missense Mutation detected in F1 DNA During 2014
sa6067 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 152 1208 3 24
Genomic Location:
Chromosome 6 (position 10401346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCAGCATGGATTCATTAGACCGACTCAAYCACACCTCCCCAGCCAGA[C/T]AAGAACAAAGTGAGGATATTTCTTTTTATGATTCCCTCTCTTTAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Missense 334 1208 6 24
Genomic Location:
Chromosome 6 (position 10433304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAATCAGATCAAGTCCAGCCTCYTGGGCTCCACGTCTGACTCAAACC[T/C]GACCAAGTACAGCACCATCAACAAGATCCCACTCATCACTCTCAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090874 Nonsense 581 1208 8 24
Genomic Location:
Chromosome 6 (position 10451178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCATGTGTATCTTTGCACTGATTGCCCATTGGTTGGCTTGCATATG[G/A]TATGCGATCGGCAATGTGGAGAGGCTCTATCTGGACCACACCATTGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhfu9znj