LOC100000044

Ensembl ID:
ENSDARG00000062672
Human Orthologue:
KCNJ3
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 3 [Source:HGNC Symbol;Acc:6264]
Mouse Orthologue:
Kcnj3
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI Symbol;Acc:MGI:104742]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11886 Nonsense Available for shipment Available now
sa41993 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090881 Nonsense 79 505 1 3
Genomic Location (Zv9):
Chromosome 12 (position 17155741)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16035451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGTCGACCTTAAGTGGYGCTGGAACCTGCTAATTTTCCTTTTAACGTA[C/A]ACGGTCGCGTGGCTCATCATGGCATCGATGTGGTGGATCATCGCGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090881 Nonsense 373 505 3 3
Genomic Location (Zv9):
Chromosome 12 (position 17135004)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16014714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCCTGGTCCTGTTCTCTCCCCTACATTGATTGAAGGTCGTCGCAGA[G/T]AGCGCATCTTTTCTTTAGATGGGGTTCCTCATTCTGATGAGCCTGGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link