oxnad1

Ensembl ID:
ENSDARG00000062664
ZFIN ID:
ZDB-GENE-060503-199
Description:
Oxidoreductase NAD-binding domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A3KP77]
Human Orthologue:
OXNAD1
Human Description:
oxidoreductase NAD-binding domain containing 1 [Source:HGNC Symbol;Acc:25128]
Mouse Orthologue:
Oxnad1
Mouse Description:
oxidoreductase NAD-binding domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916953]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44913 Nonsense Mutation detected in F1 DNA During 2017
sa5922 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090860 Nonsense 41 306 3 8
ENSDART00000128300 Nonsense 41 306 2 7
Genomic Location (Zv9):
Chromosome 19 (position 20757462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATAAACTATACGACCCTAAATGTGTTTCAGAAAAATGACATCCAGG[A/T]GACGGACTGACCATCTAGAGAGAACTGCTAGTGTTCATCGACAAATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090860 Essential Splice Site 140 306 6 8
ENSDART00000128300 Essential Splice Site 140 306 5 7
Genomic Location (Zv9):
Chromosome 19 (position 20770187)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20703567
KASP Assay ID:
554-3716.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTAGTGTTAGATTAGTCTGTTAAAAATCCTAATCCTCTTCTGTTGC[A/T]GTGCTCTGTGGACTCTCAGGTAGCCGTGAGGGTGGGGGGTAATTTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090860 Nonsense 275 306 8 8
ENSDART00000128300 Nonsense 275 306 7 7
Genomic Location (Zv9):
Chromosome 19 (position 20774598)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20707978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGMAGAAGAGCTTCAGCGTTATGTAGWCCCTGAGCGAACGCTGTGTTA[T/A]CTTTGTGGTCCTCCTCCTATGATAGAGAAAGTGASTTCAGATCTGCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link