oxnad1

Ensembl ID:
ENSDARG00000062664
ZFIN ID:
ZDB-GENE-060503-199
Description:
Oxidoreductase NAD-binding domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A3KP77]
Human Orthologue:
OXNAD1
Human Description:
oxidoreductase NAD-binding domain containing 1 [Source:HGNC Symbol;Acc:25128]
Mouse Orthologue:
Oxnad1
Mouse Description:
oxidoreductase NAD-binding domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916953]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5922 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090860 Essential Splice Site 140 306 6 8
ENSDART00000128300 Essential Splice Site 140 306 5 7
Genomic Location (Zv9):
Chromosome 19 (position 20770187)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20703567
KASP Assay ID:
554-3716.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTAGTGTTAGATTAGTCTGTTAAAAATCCTAATCCTCTTCTGTTGC[A/T]GTGCTCTGTGGACTCTCAGGTAGCCGTGAGGGTGGGGGGTAATTTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090860 Nonsense 275 306 8 8
ENSDART00000128300 Nonsense 275 306 7 7
Genomic Location (Zv9):
Chromosome 19 (position 20774598)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20707978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGMAGAAGAGCTTCAGCGTTATGTAGWCCCTGAGCGAACGCTGTGTTA[T/A]CTTTGTGGTCCTCCTCCTATGATAGAGAAAGTGASTTCAGATCTGCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link