si:ch211-195i6.4

Ensembl ID:
ENSDARG00000062661
ZFIN ID:
ZDB-GENE-070912-177
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family A (ABC1), member 4 (ABCA4) [Sou
Human Orthologue:
ABCA4
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 4 [Source:HGNC Symbol;Acc:34]
Mouse Orthologue:
Abca4
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 4 Gene [Source:MGI Symbol;Acc:MGI:109424]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16259 Nonsense Available for shipment Available now
sa19702 Nonsense Available for shipment Available now
sa19703 Nonsense Available for shipment Available now
sa25781 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16600 Nonsense Available for shipment Available now
sa19704 Nonsense Available for shipment Available now
sa19705 Essential Splice Site Available for shipment Available now
sa31266 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Nonsense 35 2350 2 52
ENSDART00000132639 Nonsense 35 879 2 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15033154)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15543981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCACGTTTAYAGATTCGCTTTTTTGTTGAGATTTTGTGGCCTGTGTTTT[T/A]ATTCWTTGGACTTGTCWGGCTGCGAAGAGCCAATCCCCTGTACCGCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Nonsense 362 2350 8 52
ENSDART00000132639 Nonsense 362 879 8 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15059168)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15569995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTTTCCTTGGCATCAACAATTCCAGGGGACACGACAGCTACATCTA[T/A]GACAAAACAGCAAGTGAGTGCATCTAATCTGTCATATTCTAACTGCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Nonsense 537 2350 12 52
ENSDART00000132639 Nonsense 537 879 12 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15068908)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15579735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTCTGGATAAGTTTGTGGGTCACATGGATGAGAATCTGATGACCCAT[C/T]AAGCTCTGCACCTGCTAGGGGAGAATAAGTTCTGGGCCGGTCTGGTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Essential Splice Site 587 2350 13 52
ENSDART00000132639 Essential Splice Site 587 879 13 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15071215)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15582042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCACCCAACTACTGAATGCATGTTTAAACAAAAGTCTGCTTTGTCTT[A/T]GATACTGGGACCCTGGCCCACGGGCAGACCCTGTGGAGGACCATCGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Nonsense 610 2350 13 52
ENSDART00000132639 Nonsense 610 879 13 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15071286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15582113
KASP Assay ID:
2259-1752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCAGACCCTGTGGAGGACYATCGCTATATCTGGGGAGGTTTTGCCTA[C/A]CTGCAGGACWTGATTGAACACGGGATCCTTAAATTACACACAGGTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Nonsense 1292 2350 27 52
ENSDART00000132639   None 879 None 17
ENSDART00000136348 Nonsense 319 374 7 8
ENSDART00000144171   None 958 None 23
Genomic Location (Zv9):
Chromosome 2 (position 15091748)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15602575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTACCGGAAGCGAAGCTGATTGAAATGATCGGTCAGGAGATGACCTA[T/A]CTGCTGCCAAATAAAGGCTTTAAATATCGAGCGTACGCCAGCCTTTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Essential Splice Site 1656 2350 36 52
ENSDART00000132639   None 879 None 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171 Essential Splice Site 264 958 7 23
Genomic Location (Zv9):
Chromosome 2 (position 15100215)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15611042
KASP Assay ID:
2259-1755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAAAACATTTTCTCTCAGCTTGGAAGAATGATGAATATCAGAGGGG[T/C]ATGCAATTGTATAAACATCACATAAATGAGATTCAGATAAGAGGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090760 Essential Splice Site 1681 2350 37 52
ENSDART00000132639   None 879 None 17
ENSDART00000136348   None 374 None 8
ENSDART00000144171 Essential Splice Site 289 958 8 23
Genomic Location (Zv9):
Chromosome 2 (position 15100402)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15611229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTAGAAACTTTCCTGCACTACATGGAGAGCGAGTACAATGTTAAG[G/A]TATGTTATGTCACCTATTTACAAATCTCTCAAACTTTAGCCACATTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link