ydjc

Ensembl ID:
ENSDARG00000062655
ZFIN ID:
ZDB-GENE-060526-182
Description:
UPF0249 protein ydjC homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BIR6]
Human Orthologue:
YDJC
Human Description:
YdjC homolog (bacterial) [Source:HGNC Symbol;Acc:27158]
Mouse Orthologue:
Ydjc
Mouse Description:
YdjC homolog (bacterial) Gene [Source:MGI Symbol;Acc:MGI:1916351]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3534 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090851 Nonsense 143 313 4 5
Genomic Location:
Chromosome 5 (position 14535205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAGTCMTTGCTGAATATAATTTTTWAAAAATATTTTTTTCAGATGTG[C/T]GAGAGGTCTTTGCACAAGTTCTCTCTGATTTTGGGATCACCTACACCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f6usjbac