rif1

Ensembl ID:
ENSDARG00000062650
ZFIN ID:
ZDB-GENE-030131-3406
Description:
telomere-associated protein RIF1 [Source:RefSeq peptide;Acc:NP_001074275]
Human Orthologue:
RIF1
Human Description:
RAP1 interacting factor homolog (yeast) [Source:HGNC Symbol;Acc:23207]
Mouse Orthologue:
Rif1
Mouse Description:
Rap1 interacting factor 1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1098622]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7629 Missense Mutation detected in F1 DNA During 2014
sa6113 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10257 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Missense 241 2347 7 34
ENSDART00000110992 Missense 248 2392 7 35
ENSDART00000143972 Missense 248 2392 8 36
Genomic Location:
Chromosome 9 (position 23820831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCTGTAGGTGCTCATCCCTGAAATGCAGAAGCTCTTTGCGTCTAAGA[A/T]CGAGACAAACATGTTGAAACTCTGGCCTTTGTTTGTAAGACTTCTGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Essential Splice Site 740 2347 19 34
ENSDART00000110992 Essential Splice Site 785 2392 20 35
ENSDART00000143972 Essential Splice Site 785 2392 21 36
Genomic Location:
Chromosome 9 (position 23826448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATGGACTTTTCTCCATATACCCCTCAGTTCCAGCAGAAGATGAAATG[T/C]AAGGCTTTGGCTTCAGATTTCAGTTTTATAACACTATCTTGTGACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090816 Nonsense 2111 2347 30 34
ENSDART00000110992 Nonsense 2156 2392 31 35
ENSDART00000143972 Nonsense 2156 2392 32 36
Genomic Location:
Chromosome 9 (position 23833622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATCTTCTTTTGTTGCAGTATATCACTACACCAACAAAAGGYGGCTA[T/A]ACAAGTCTGAGTCCACGTAACCTCCGTAGCCCTGGATCCAAAAGCTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fnchnvoh