si:ch211-220a11.1

Ensembl ID:
ENSDARG00000062646
ZFIN ID:
ZDB-GENE-060526-109
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CEA2]
Human Orthologue:
TET3
Human Description:
tet oncogene family member 3 [Source:HGNC Symbol;Acc:28313]
Mouse Orthologue:
Tet3
Mouse Description:
tet oncogene family member 3 Gene [Source:MGI Symbol;Acc:MGI:2446229]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9686 Essential Splice Site Available for shipment Available now
sa33552 Nonsense Available for shipment Available now
sa16660 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090796 Essential Splice Site 218 1101 4 10
ENSDART00000137355 Essential Splice Site 218 1101 5 11
Genomic Location (Zv9):
Chromosome 5 (position 16021596)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13817464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGGGCGAGAAGGAAAGAGCTCTCAGGGATGTCCTATTGCTAAGTGGG[T/A]AAGTTTGCAATYKAMATATATTTAAAATCAGCTAGCYGMGTGCTTACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090796 Nonsense 584 1101 10 10
ENSDART00000137355 Nonsense 584 1101 11 11
Genomic Location (Zv9):
Chromosome 5 (position 16015385)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13811253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCTGATCCCCATAACATGAACAGTTCGTTCTCCTACCCTGGGAACTA[T/A]GCAAGAGGTCGCATCCCTGGCAACAGTCATCCTCCTGCACAGAACCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090796 Nonsense 662 1101 10 10
ENSDART00000137355 Nonsense 662 1101 11 11
Genomic Location (Zv9):
Chromosome 5 (position 16015153)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13811021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCATTTRAACAGAAGCCGGATGTTCAGTGTCTCCAAGCCAATCTGGCA[C/T]AGGCCTATCCMACCCATCATGGACAGYCTCAGGCACAAAYRGCTGATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link