kcnh8

Ensembl ID:
ENSDARG00000062640
ZFIN ID:
ZDB-GENE-060503-204
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, subfamily H (Eag-related), memb
Human Orthologue:
KCNH8
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 8 [Source:HGNC Symbol;Acc:18864]
Mouse Orthologue:
Kcnh8
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 8 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23505 Nonsense Available for shipment Available now
sa31032 Nonsense Mutation detected in F1 DNA During 2017
sa32242 Nonsense Available for shipment Available now
sa39241 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090810 Nonsense 245 996 5 16
ENSDART00000132914 Nonsense 245 694 5 12
Genomic Location (Zv9):
Chromosome 19 (position 21052215)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20985595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTTCTGGCTACCTTTTATGTGGCTGTTACGGTGCCGTACAATGTTTG[T/A]TTTATAGGTGATCAAGATTTGACACGCAGCACCACCGTCACTGACATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090810 Nonsense 707 996 13 16
ENSDART00000132914   None 694 None 12
Genomic Location (Zv9):
Chromosome 19 (position 21108097)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21041477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAATCACAGATGGAGGGGAGGGGAAACGGAGATGCGATCCAGTGCTA[T/A]CCACCAATAGCTGAGCATCACAATGAAGAAGATGACGATGACGACGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090810 Nonsense 752 996 13 16
ENSDART00000132914   None 694 None 12
Genomic Location (Zv9):
Chromosome 19 (position 21108230)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21041610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAAACAGAAAACACACATGCAGAAAAATGATCACCAAACCAACAAA[A/T]AGCTCCACATTCAGCACACCACTGTCACGAAACCTGACCTCGGAAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090810 Nonsense 821 996 15 16
ENSDART00000132914   None 694 None 12
Genomic Location (Zv9):
Chromosome 19 (position 21112386)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21045766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTCTCTGTGCAGAATTAGCTGCTAAATCGGAGGACACCCGAGGA[C/T]AGCTACGCCATCTTAACCAAGAGGTAAATTATTTTCTGCTCATTCTCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link