duox

Ensembl ID:
ENSDARG00000062632
ZFIN ID:
ZDB-GENE-091117-14
Description:
Dual oxidase 1 [Source:UniProtKB/TrEMBL;Acc:Q08JS2]
Human Orthologues:
DUOX1, DUOX2
Human Descriptions:
dual oxidase 1 [Source:HGNC Symbol;Acc:3062]
dual oxidase 2 [Source:HGNC Symbol;Acc:13273]
Mouse Orthologues:
Duox1, Duox2
Mouse Descriptions:
dual oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:2139422]
dual oxidase 2 Gene [Source:MGI Symbol;Acc:MGI:3036280]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9892 Nonsense Available for shipment Available now
sa13017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090727 Nonsense 945 1528 21 33
Genomic Location (Zv9):
Chromosome 25 (position 32977139)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31588083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCYCTGTTTGCAGGCATGGAAGTACTTGGTAAGAAAAAACTAGSCAGA[C/T]AGCACAAGGTAWCTTTCATCAGGAAAAACAGGTAAGAGAAAACATCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090727 Nonsense 998 1528 23 33
Genomic Location (Zv9):
Chromosome 25 (position 32980661)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31591605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGAGCTGGACAAAGCCAAGCCAAGCTGTACGTCAGGCCTCAGAGAGAG[C/T]GATTCAACARAAACCCAGTGCAGCAGTGCGTGCAGCAGTTCAAACGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link