npffr1l2

Ensembl ID:
ENSDARG00000062631
ZFIN ID:
ZDB-GENE-060526-110
Description:
RFamide-related peptide receptor [Source:RefSeq peptide;Acc:NP_001165168]
Human Orthologue:
NPFFR1
Human Description:
neuropeptide FF receptor 1 [Source:HGNC Symbol;Acc:17425]
Mouse Orthologue:
Npffr1
Mouse Description:
neuropeptide FF receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2685082]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20360 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090788 Nonsense 475 484 4 4
ENSDART00000135731 Nonsense 471 480 3 3
Genomic Location (Zv9):
Chromosome 5 (position 15869514)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13665382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAACCAAAAAGCCTTTCAGATGGAGGAGGCAGAGAAAAAAAGTCCCATC[A/T]GAGGGAGTAAAAACCAAGCCTGGGATCAGTAGACGGATTACAGTCGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link