dnah9l

Ensembl ID:
ENSDARG00000062630
ZFIN ID:
ZDB-GENE-050506-1
Description:
Dynein heavy chain 9-related protein [Source:UniProtKB/TrEMBL;Acc:Q56HA9]
Human Orthologue:
DNAH11
Human Description:
dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
Mouse Orthologue:
Dnahc11
Mouse Description:
dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11038 Essential Splice Site Available for shipment Available now
sa20655 Nonsense Available for shipment Available now
sa33819 Nonsense Mutation detected in F1 DNA During 2017
sa33818 Nonsense Mutation detected in F1 DNA During 2017
sa20654 Nonsense Available for shipment Available now
sa38541 Nonsense Mutation detected in F1 DNA During 2017
sa20653 Nonsense Available for shipment Available now
sa9392 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33817 Nonsense Mutation detected in F1 DNA During 2017
sa20652 Essential Splice Site Available for shipment Available now
sa20651 Essential Splice Site Available for shipment Available now
sa20650 Nonsense Available for shipment Available now
sa40642 Nonsense Mutation detected in F1 DNA During 2017
sa33816 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Essential Splice Site 565 4461 11 84
Genomic Location (Zv9):
Chromosome 6 (position 10593979)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10447605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGCTCTTGAACATGTTCAAGTACTTCTGTGTTGTTTTAYGTGGTACA[G/A]CTRAGGACCGGCAGTCCCATCCTTGGTAAAAACATGCCAGCTGTTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 608 4461 12 84
Genomic Location (Zv9):
Chromosome 6 (position 10593721)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10447347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCGTGTGCGTGCGTGTGTGTGTGTGTGTGTGTGTGTGTTTAGGCCAT[T/A]GGAGAGTTCTGAGGCCAAGCAGGTGCTGCAGATGTGTGAGTGTGTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 798 4461 15 84
Genomic Location (Zv9):
Chromosome 6 (position 10590994)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10444620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGGAGAAACTGCAGGGGCTGATGGGAGTTTTCAGTCACTCGGCCTG[T/A]ATTACACGTAAGACTAGCCATCGGGGGAATCTGCTGAACCTCACCGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 918 4461 16 84
Genomic Location (Zv9):
Chromosome 6 (position 10589059)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10442685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGATCTTTCACCCCTCGCTCAACCTCTCCAGGAAAGGCAACTTCTA[T/A]GACATCATTGACCAGATGGTGTCAGACATTTTTAAAATGGCTTCCTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 1031 4461 17 84
Genomic Location (Zv9):
Chromosome 6 (position 10586302)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10439928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGCAGATTATGAGCTACCTAAGAATCCACCCAAACTGCAGAACTTC[A/T]GAGAGCAGGTATCTGTCAGTCATGGAGTGAATAATAAAAGTGATTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 1805 4461 34 84
Genomic Location (Zv9):
Chromosome 6 (position 10570106)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10423732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATGGGCCGAGCAGCAGAAGCACTGTTATATCAACATCTGTGATGCA[C/T]AGTTTCAGTTCTCATACGAGTATCTAGGGAATACTAACAGATTGGTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 1984 4461 38 84
Genomic Location (Zv9):
Chromosome 6 (position 10565084)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10418710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGTGCAATGGTGATTCCAGATTATGAGTTAATCTGTGAAATCTTGT[T/A]GGTGGCGGAAGGTTTTCTCGATGCACGGCTGCTTGCACGCAAGTTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Essential Splice Site 2180 4461 42 84
Genomic Location (Zv9):
Chromosome 6 (position 10562499)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10416125
KASP Assay ID:
2259-7217.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGCTGTTTGGCTTTCTCCACCCAGCCACACGGGAGTGGAAAGATGG[T/A]GTGTGTGTATGTGGGTGTTTATGTGCAGTCTCTTAGTTTAAGGATCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 3003 4461 58 84
Genomic Location (Zv9):
Chromosome 6 (position 10536183)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10389809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTATCTCATTCGCTCACACTTGTGTGAATGAAGTCAGTGTAAAGTA[T/A]CAGCAGAATGAAAAGCGCTTCAATTACACCACACCCAAGAGCTTCTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Essential Splice Site 3191 4461 61 84
Genomic Location (Zv9):
Chromosome 6 (position 10533227)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10386853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCCCTAAAGACCGCAGCTGGAAAGCATCTAAAGTTGTCATGAGTAAA[G/A]TGAGTGAGTGTAGGGCTGACATTTGTAAATGTTCCTATTTTACTTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Essential Splice Site 3286 4461 63 84
Genomic Location (Zv9):
Chromosome 6 (position 10527006)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10380632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGTTGAGGCTGCAGAAAAGTTAGAGATCATCAGAAAGAAGCTGGCC[G/A]TAAGTATCTCTTATTTGCTCTCTCGATATCTCATCATTGTTTTACAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 3374 4461 65 84
Genomic Location (Zv9):
Chromosome 6 (position 10525358)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10378984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCGGCCTTCATCTCTTATGCTGGATCTTTCTCAAAGAGATACAGATA[T/G]GAGTTGCTCCATAACCTCTGGATGCCCTATCTCCGTGCACAAAAGGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 4015 4461 77 84
Genomic Location (Zv9):
Chromosome 6 (position 10505150)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10358776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTAATCAACTGCAAACATGTCTGTTCATGCGTAGGACATTCTGGAC[C/T]AGTGTTCCCGTGAGCAGGAGTTTAAGACCATCCTGTTCTCGCTGTGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125876 Nonsense 4180 4461 79 84
Genomic Location (Zv9):
Chromosome 6 (position 10504382)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10358008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGTGATGTCCGACAGCCTCTTCCACACTCTTCTAGAGCTTCAGTCC[A/T]GAGACTCCAGCATGGGGGAAGGAGCTTCGCAGACCACTGAAGAGAAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link