SACS (2 of 2)

Ensembl ID:
ENSDARG00000062627
Description:
spastic ataxia of Charlevoix-Saguenay (sacsin) [Source:HGNC Symbol;Acc:10519]
Human Orthologue:
SACS
Human Description:
spastic ataxia of Charlevoix-Saguenay (sacsin) [Source:HGNC Symbol;Acc:10519]
Mouse Orthologue:
Sacs
Mouse Description:
sacsin Gene [Source:MGI Symbol;Acc:MGI:1354724]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42539 Nonsense Mutation detected in F1 DNA During 2017
sa28446 Nonsense Mutation detected in F1 DNA During 2017
sa32032 Nonsense Available for shipment Available now
sa14729 Nonsense Available for shipment Available now
sa35878 Nonsense Mutation detected in F1 DNA During 2017
sa12071 Nonsense Available for shipment Available now
sa18161 Nonsense Available for shipment Available now
sa7404 Missense Mutation detected in F1 DNA During 2017
sa10203 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 325 4578 7 9
Genomic Location (Zv9):
Chromosome 15 (position 21874165)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9413745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCTCTTTCTAAAGAGCGTGCAGAAGGTCTCTCTGCATATACGGGAAT[C/A]AGATGGAACAGAGCGGATGCTTTTCCAGGTCACAGCAAGCGATAGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 1306 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21883174)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9404736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAGTTTTAAAGCCCATACCAGATTTGGACCTGCAACCTTACTTGTA[C/A]TCGTTACCAAAGACTATTGCAAAATTCAACAAGCTTTTTAAATTCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 1412 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21883491)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9404419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCATGAATGCACTTACTGTGACATCAAAGTAGAAGACCTGAATGACT[T/A]ACTAGATGATGCTTCCGAGCCCATCATCCTTGTCCATGATGACATTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 1897 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21884946)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9402964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAAAACTGGCTTACCTGTCCACATAAATGGTTGCYTCGCTGTCACAT[C/A]AAATCGCAAAGAAATCTGGAAGACAGACACCAAAGGACAATGGAATTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 1967 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21885157)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9402753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTGGAGTTGTCCATGATGATTTCAATCTGATTTGTCAAGGTGTTTA[T/A]CAAGAAATAGCCAAAGGTGCTGATGATGATCGTGCAAAAGTCTTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 2081 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21885499)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9402411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCCCATAWCCAAGACATAGATAAGGACCTACGGGACCCTCTGATGTA[T/G]TATGTACTCAATGAAAAACTTGAGGATTTTGCATCYATACTGAAGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 2403 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21886464)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9401446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTTGAAAATGTGGGAGTTCACGCAAGCTTCACTGTTGAAACGTTCT[C/A]AGGTGTTTTACAGCYGATAAAGAATGAATGTGGGAGAAAACCTYTMACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Missense 2508 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21886779)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9401131
KASP Assay ID:
554-4373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAAGTAGCAGTAAAACTGGGGGCAATTCCGAAACGTCACAAAGCCT[T/C]AGAAAGATAYGCCTCCAACATTTGCTTCACTACCCTTGGCAGTGAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090779 Nonsense 3377 4578 9 9
Genomic Location (Zv9):
Chromosome 15 (position 21889385)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9398525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCAGCATACTTCGAGCWCTTGAGTACATGATCCAGATATCCGCTTTC[A/T]AAACAGCAAGTTTGACTGATAAAGATTTCGATGCTTTGCTGTTGTACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link