dhx37

Ensembl ID:
ENSDARG00000062612
ZFIN ID:
ZDB-GENE-030131-4505
Description:
probable ATP-dependent RNA helicase DHX37 [Source:RefSeq peptide;Acc:NP_001076473]
Human Orthologue:
DHX37
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 37 [Source:HGNC Symbol;Acc:17210]
Mouse Orthologue:
Dhx37
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene [Source:MGI Symbol;Acc:MGI:3028576]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21183 Nonsense Available for shipment Available now
sa41108 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38663 Nonsense Mutation detected in F1 DNA During 2017
sa12030 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090731 Nonsense 495 1152 13 29
ENSDART00000127153 Nonsense 495 1152 13 29
Genomic Location (Zv9):
Chromosome 8 (position 4741475)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4484506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTGAGGTTCATTCTGTGTGTCGGAGGCTGAGAAAAGCTTTCCCTTA[T/G]AAACCAAACCGAGAGCACACAGGTACGCACTGATTAGATTCATCTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090731 Essential Splice Site 596 1152 16 29
ENSDART00000127153 Essential Splice Site 596 1152 16 29
Genomic Location (Zv9):
Chromosome 8 (position 4735465)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4478496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGTGCTTCCGCTTTACTCTCTGCTAGCACCTGAGCAGCAGGCCAAGG[T/C]AAGTACTTCAAATAATCCTTACAACAGAAATATTGTCTGAGAACTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090731 Nonsense 682 1152 18 29
ENSDART00000127153 Nonsense 682 1152 18 29
Genomic Location (Zv9):
Chromosome 8 (position 4732147)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4475178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAAAAAAAACTGTGTGTGTGTTTAGGCTGTACTCGTCTGCTGTGTTC[G/T]GAGATTTCAGTTTGTTTTCGGAGGCTGAAATCACACGGCGTCCTGTCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090731 Essential Splice Site 852 1152 21 29
ENSDART00000127153 Essential Splice Site 852 1152 21 29
Genomic Location (Zv9):
Chromosome 8 (position 4729805)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4472836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGACAAGGAGCGTCTCTTCTGCTCGGAGATCTGATGGTTCTGCTCGG[T/C]ACYTTCATTTAATTTCTAAAGTTCATGTMAAATGTTCYGATGTTCAGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link