ENSDARG00000062610

Ensembl ID:
ENSDARG00000062610
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27596 Nonsense Mutation detected in F1 DNA During 2017
sa38795 Nonsense Mutation detected in F1 DNA During 2017
sa41645 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064535 Nonsense 36 819 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21763654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGTCGTGTTTATCCATGGAGGGTCTTATTCATCATGGCCGTTTTTT[C/A]GATCTTAAAGACAAACGCACAGATTCGGTATTCAGTTCCAGAGGAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064535 Nonsense 747 819 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21765788)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21729046
GRCz10 10 21746504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAATCTCGCTTCCTTTATCAGTCCAATCTGCCTGTTATTCCGTACTA[T/G]CCACCGCATTACGCAGACACAGGAGTCACTGGAACTCTGCCACACGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064535 Nonsense 810 819 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21765976)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21743047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAGTTTCAGTGAGACGATGCAGCGCGCAGTGAAGGAAAATCGTTGTT[T/G]AAAAGATGCAGAGGAGTGTCTGGAAACGGTAAGATCGCATTATATTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link