piwil2

Ensembl ID:
ENSDARG00000062601
ZFIN ID:
ZDB-GENE-060526-345
Description:
Piwi-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A2CEI6]
Human Orthologue:
PIWIL2
Human Description:
piwi-like 2 (Drosophila) [Source:HGNC Symbol;Acc:17644]
Mouse Orthologue:
Piwil2
Mouse Description:
piwi-like homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1930036]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3173 Nonsense Available for shipment Available now
sa18254 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090695 Nonsense 51 1046 2 23
ENSDART00000110437   None 292 2 9
ENSDART00000134274 Nonsense 51 1087 2 23
ENSDART00000136004 Nonsense 51 214 2 5
Genomic Location (Zv9):
Chromosome 5 (position 18249959)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15968292
KASP Assay ID:
554-0412.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGGGACGGGCCAGAGGTCTTATCATGCCCATAGATGAACCTCTTCCT[G/T]GACGAGGTAGAGCTTTTAGTGTACCCGGAGAAATGCCGGTGAGATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090695 Nonsense 533 1046 12 23
ENSDART00000110437   None 292 None 9
ENSDART00000134274 Nonsense 533 1087 12 23
ENSDART00000136004   None 214 None 5
Genomic Location (Zv9):
Chromosome 5 (position 18227672)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15946005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NTNAATTGTCAGTTTTTATTCATTGGCTTTTTATGTGAACAGAAAGAACTA[T/A]GGGATTWCCATAAAGGAACTGGACCARCCGCTGCTCATTCATCGWCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link