nlgn3a

Ensembl ID:
ENSDARG00000062581
ZFIN ID:
ZDB-GENE-071219-1
Description:
neuroligin-3 [Source:RefSeq peptide;Acc:NP_001159804]
Human Orthologue:
NLGN3
Human Description:
neuroligin 3 [Source:HGNC Symbol;Acc:14289]
Mouse Orthologue:
Nlgn3
Mouse Description:
neuroligin 3 Gene [Source:MGI Symbol;Acc:MGI:2444609]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11831 Nonsense Available for shipment Available now
sa22451 Essential Splice Site Available for shipment Available now
sa35667 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090691 Nonsense 162 878 1 7
ENSDART00000126074 Nonsense 139 815 1 5
ENSDART00000145750 Nonsense 139 830 1 5
Genomic Location (Zv9):
Chromosome 14 (position 18215476)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14009929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATKCCAATYTGGTTCACATTTAACTTGGATATAGTTGCAACTTCTATA[C/T]AGGATCAAAATGAAGATTGTTTGTATCTAAACAKCTATGTTCCAACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090691 Essential Splice Site 595 878 6 7
ENSDART00000126074 Essential Splice Site 532 815 4 5
ENSDART00000145750 Essential Splice Site 547 830 4 5
Genomic Location (Zv9):
Chromosome 14 (position 18402986)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14197439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCAGTGCTGTTGTCATGACCTACTGGACTAACTTTGCCAAAACTGG[G/A]TAAGTGCTTAAATGACAGCATGAAAGTATAATACTGTACATGTGCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090691 Nonsense 769 878 7 7
ENSDART00000126074 Nonsense 706 815 5 5
ENSDART00000145750 Nonsense 721 830 5 5
Genomic Location (Zv9):
Chromosome 14 (position 18432513)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14226966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGCATTTGCTGCTCTGTACTATCGCAAGGATAAGCGGCGACAAGAA[C/T]AGCACCCGCAACCCAGCCCACCACGAGCCACTACTACCAATGATGTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link