LOC100004299

Ensembl ID:
ENSDARG00000062577
Human Orthologue:
GRLF1
Human Description:
glucocorticoid receptor DNA binding factor 1 [Source:HGNC Symbol;Acc:4591]
Mouse Orthologue:
Grlf1
Mouse Description:
glucocorticoid receptor DNA binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1929494]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5876 Nonsense Mutation detected in F1 DNA During 2014
sa22592 Nonsense Mutation detected in F1 DNA During 2014
sa1378 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090675 Nonsense 138 1536 1 6
Genomic Location:
Chromosome 15 (position 8800085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCACCAAGCTGGCCTCTGCTGAGAAGCTCATGTATTTCTGCACAGAT[C/T]AGCTTGGACTAGAGCAAGACTTTGAGCAGAAACAAATGCCTGAAGGYAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090675 Nonsense 722 1536 1 6
Genomic Location:
Chromosome 15 (position 8798333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCAAAAGAGGTGTTGGATCAATTTCTGACATTGGGGGTGAAACAGCA[C/T]AGACCCTGATCCAACAAGGTCAGCAAGTGGCTGGCAGATTTCAGTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090675 Essential Splice Site 1320 1536 3 6
Genomic Location:
Chromosome 15 (position 8777093)
KASP Assay ID:
554-1290.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGGAAATAAGGCCGAGATGGAAAGCATGCAGCGGCAGTTTGATCAGG[G/A]TGAGTCAAATGACTGGCGTCTACTTTTGCTTTCCTCTTCTTTCGATCTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wjmjpqu0