si:ch211-210g13.5

Ensembl ID:
ENSDARG00000062575
ZFIN ID:
ZDB-GENE-030131-5675
Human Orthologue:
PLCL2
Human Description:
phospholipase C-like 2 [Source:HGNC Symbol;Acc:9064]
Mouse Orthologue:
Plcl2
Mouse Description:
phospholipase C-like 2 Gene [Source:MGI Symbol;Acc:MGI:1352756]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12851 Nonsense Available for shipment Available now
sa9500 Nonsense Available for shipment Available now
sa19973 Nonsense Available for shipment Available now
sa40030 Nonsense Mutation detected in F1 DNA During 2017
sa38379 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090676 Nonsense 147 1122 2 6
ENSDART00000131584 Nonsense 33 1000 4 8

The following transcripts of ENSDARG00000062575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 17100505)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17306838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGGAAGGCTGTGAGATGAAGAAAGTTCGTTCTAATTCTCGCATGTA[C/A]AATCGTTACTTCCTGTTGGATCCTGACATGCGCTGGCTCCGCTGGGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090676 Nonsense 376 1122 2 6
ENSDART00000131584 Nonsense 262 1000 4 8

The following transcripts of ENSDARG00000062575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 17101192)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17307525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGGAGGGTGTCACAGAGGAAATGTGTCGGGAGATTGTGCATAAGTA[C/A]GAACCCTCTGCTGAAGGACGTAATAATGGCTACTTGTCCATAGATGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090676 Nonsense 424 1122 2 6
ENSDART00000131584 Nonsense 310 1000 4 8

The following transcripts of ENSDARG00000062575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 17101336)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17307669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACAAGCATGTTTGTCAGGACATGACGCAGCCCCTTTCACACTACTA[C/A]ATCAATTCTTCTCACAATGCCTCACTTTTAGAAGATCACTACTGGGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090676 Nonsense 475 1122 2 6
ENSDART00000131584 Nonsense 361 1000 4 8

The following transcripts of ENSDARG00000062575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 17101487)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17307820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGGTTGTAGTCTGGGATGGTCCTGACTGTGAGCCTGTGGTCTATGTT[G/T]GAAGCTCTGTTGCATCCCAGCTGGCCTTTTGTAAAATTCTTGATGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090676 Nonsense 856 1122 2 6
ENSDART00000131584 Nonsense 742 1000 4 8

The following transcripts of ENSDARG00000062575 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 17102630)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17308963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCCTGCTTCCCGGTTACCGGCATGTACCACTGCAGTCACTTACAGGG[G/T]AGTTTTTGCCCAACACCACGCTGTTCGTTCACGTTGCTATTACAAACCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link