im:6908224

Ensembl ID:
ENSDARG00000062568
ZFIN ID:
ZDB-GENE-050809-12
Human Orthologue:
MRPL2
Human Description:
mitochondrial ribosomal protein L2 [Source:HGNC Symbol;Acc:14056]
Mouse Orthologue:
Mrpl2
Mouse Description:
mitochondrial ribosomal protein L2 Gene [Source:MGI Symbol;Acc:MGI:1351622]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42317 Nonsense Mutation detected in F1 DNA During 2017
sa42316 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090644 Nonsense 18 294 1 6
Genomic Location (Zv9):
Chromosome 13 (position 53984740)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51659327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGTGGGTCTGCTGTCGTCTGCTCTGAGGGCTCTGTGTCTGTCGGGCT[C/A]GCGGACGGTCAGTTCTCAGGTCAGTTCTTCATCTTCTCCATAATCGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090644 Essential Splice Site 224 294 5 6
Genomic Location (Zv9):
Chromosome 13 (position 53981160)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51655747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGAGCGGCACCGCCATCATTCAGCTTCCCTCTAAACACCAGATTCAG[G/A]TGAGATTGAACAGACAAGTTTACATCACGCCCACAGCAAAACTCTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link