adck1

Ensembl ID:
ENSDARG00000062561
ZFIN ID:
ZDB-GENE-080401-5
Description:
aarF domain containing kinase 1 [Source:RefSeq peptide;Acc:NP_001116521]
Human Orthologue:
ADCK1
Human Description:
aarF domain containing kinase 1 [Source:HGNC Symbol;Acc:19038]
Mouse Orthologue:
Adck1
Mouse Description:
aarF domain containing kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1919363]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23035 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090631 Nonsense 89 521 3 10
ENSDART00000123845 Nonsense 21 453 2 9
Genomic Location:
Chromosome 17 (position 17477807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTCACAGGCGCTCAGCGGAGAGGCTGCTGGACTTGTGTTGTGCGAAC[A/T]GAGGCACCTTCATTAAAGTAGGCCAGCACCTGGGAGCCCTGGAGTACCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sfsb5ovp