rspry1

Ensembl ID:
ENSDARG00000062558
ZFIN ID:
ZDB-GENE-061026-2
Description:
RING finger and SPRY domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001038537]
Human Orthologues:
RNF123, RSPRY1
Human Descriptions:
ring finger and SPRY domain containing 1 [Source:HGNC Symbol;Acc:29420]
ring finger protein 123 [Source:HGNC Symbol;Acc:21148]
Mouse Orthologues:
Rnf123, Rspry1
Mouse Descriptions:
ring finger and SPRY domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914860]
ring finger protein 123 Gene [Source:MGI Symbol;Acc:MGI:2148796]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43079 Nonsense Mutation detected in F1 DNA During 2016
sa16314 Nonsense Available for shipment Available now
sa32199 Essential Splice Site Available for shipment Available now
sa23276 Essential Splice Site Available for shipment Available now
sa23277 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090608 Nonsense 271 580 8 15
Genomic Location (Zv9):
Chromosome 18 (position 17398215)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17749981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCATTATTCGTTTCAGGTGAGAACAAGTTAACGGTGTCAGAGTCATG[T/A]ATCAGTGACCGTTTGTCTGTTCTGGAATCCTGGGCAGATAACTTAGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090608 Nonsense 359 580 10 15
Genomic Location (Zv9):
Chromosome 18 (position 17402320)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17754086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCCCGTTGTGAYGCATCATCATTTGAGAGCGTCCGCTGCACGTTCTG[T/A]GTGGWTTCGGGGGTTTGGTACTATGAGGTCACGGTTATCACCTCTGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090608 Essential Splice Site 391 580 10 15
Genomic Location (Zv9):
Chromosome 18 (position 17402418)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17754184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATGCAAATTGGCTGGGCAACCAAGGACAGCAAGTTTCTCAACCATG[T/C]GTGTTTTAATTAAGCTCCTTTATTTCTGATTTCTCCCTTAGCTTCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090608 Essential Splice Site 463 580 12 15
Genomic Location (Zv9):
Chromosome 18 (position 17404708)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17756474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAACGGACACCAGCTGCCTCCTGAGAAGCAGGTGTTCTTCTCTGCCAC[G/A]TAAGCGAAGATCACTTCCTTAACCTTAAAACGAGCATGATGGAACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090608 Essential Splice Site 514 580 13 15
Genomic Location (Zv9):
Chromosome 18 (position 17404938)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17756704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGAGTTTGCCTCGCTCGCATCAGACGAGAAAATCATTCTGCCCAGG[T/C]TTGCACCATTTATTAGATTGCTGTACAAAGGGTGAAGTATCAATGGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link