rc3h1

Ensembl ID:
ENSDARG00000062550
ZFIN ID:
ZDB-GENE-050208-702
Description:
ring finger and CCCH-type zinc finger domains 1 [Source:RefSeq peptide;Acc:NP_001076328]
Human Orthologue:
RC3H1
Human Description:
ring finger and CCCH-type domains 1 [Source:HGNC Symbol;Acc:29434]
Mouse Orthologue:
Rc3h1
Mouse Description:
RING CCCH (C3H) domains 1 Gene [Source:MGI Symbol;Acc:MGI:2685397]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24123 Nonsense Mutation detected in F1 DNA During 2014
sa16237 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Nonsense 660 1078 11 19
ENSDART00000144545 Nonsense 660 1078 12 20
Genomic Location:
Chromosome 22 (position 16148390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACGCCAATCCTAGCGCTCATTATGGATACCCTTCACGCCATGACAAC[C/T]GATGCCACTCACCCTACGCTCATCCCCAAACATTCGCCCCACGTGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Nonsense 807 1078 13 19
ENSDART00000144545 Nonsense 807 1078 14 20
Genomic Location:
Chromosome 22 (position 16151455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTACACTGCCTCATATTCACCATGGTTATGTGACACCATCGGTTCTTA[C/A]ATCGGCAGCAAAGACATGAAGTCCAAAGAGGGCATGCACTCCAYGGAMGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/403amcly