si:dkey-215k6.1

Ensembl ID:
ENSDARG00000062538
ZFIN ID:
ZDB-GENE-060526-251
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE95]
Human Orthologues:
TMEM132C, TMEM132D
Human Descriptions:
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
Mouse Orthologues:
Tmem132c, Tmem132d
Mouse Descriptions:
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090580 Nonsense 91 616 2 5
ENSDART00000145878   None 178 None 3
Genomic Location (Zv9):
Chromosome 5 (position 20224139)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17936699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGAGGATGATGAGGAGGATGAGAGGAAGGGCAAAGGCTGTGCCCTG[C/T]AGTATCAGTATGCTCTRGTGCGTGTTCTCACACACTTTGTAGCCGAGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link