mapk8ip3

Ensembl ID:
ENSDARG00000062531
ZFIN ID:
ZDB-GENE-090303-6
Human Orthologue:
MAPK8IP3
Human Description:
mitogen-activated protein kinase 8 interacting protein 3 [Source:HGNC Symbol;Acc:6884]
Mouse Orthologue:
Mapk8ip3
Mouse Description:
mitogen-activated protein kinase 8 interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1353598]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8849 Nonsense Mutation detected in F1 DNA During 2016
sa40025 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090496 Nonsense 179 1311 4 34
ENSDART00000139206 Nonsense 179 1302 4 31
Genomic Location (Zv9):
Chromosome 3 (position 15526597)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15772198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCCAGATGATTMAGACATATGTGGAACACATTGAACGCTCAAAGTTG[C/T]AGCWGTCAGGCAGCAACCAGTCTGAATCCACAGGCTGCGGACGGTCGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090496 Nonsense 962 1311 26 34
ENSDART00000139206 Nonsense 953 1302 23 31
Genomic Location (Zv9):
Chromosome 3 (position 15578799)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15824400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATCTCAGACATCATATGCATCATGTAAACTCTCTCCACAGGCTGTA[T/A]GTCCACTCTGCAGTGTCCAACTGGAAGAAATGCCTCCATTCGATTAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link