atp9b

Ensembl ID:
ENSDARG00000062521
ZFIN ID:
ZDB-GENE-060503-583
Description:
probable phospholipid-transporting ATPase IIB [Source:RefSeq peptide;Acc:NP_001038619]
Human Orthologue:
ATP9B
Human Description:
ATPase, class II, type 9B [Source:HGNC Symbol;Acc:13541]
Mouse Orthologue:
Atp9b
Mouse Description:
ATPase, class II, type 9B Gene [Source:MGI Symbol;Acc:MGI:1354757]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23507 Nonsense Available for shipment Available now
sa8437 Nonsense Mutation detected in F1 DNA During 2016
sa43270 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090476 Nonsense 88 1125 3 29
ENSDART00000136294 Nonsense 49 1108 2 28
Genomic Location (Zv9):
Chromosome 19 (position 22576421)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22507801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGATGATCTTTTTTCCTCTCCGTGGTCTCTGTCACGCAGCTGTTGC[G/T]AATGTCTGGTTCACACATGTCGCAGAAAGAAGGAGCTGAAAGCTCGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090476 Nonsense 138 1125 4 29
ENSDART00000136294 Nonsense 99 1108 3 28
Genomic Location (Zv9):
Chromosome 19 (position 22578576)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22509956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTNNTCTCTCTCTCTCTTTCTCTCTCTTTCTTTTCTTTTAGGTTCTTTA[C/A]CAGCAGTTTAAGTTCTTCCTCAACTTGTATTTTCTAGTAGTGGCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090476 Nonsense 1078 1125 28 29
ENSDART00000136294 Nonsense 1061 1108 27 28
Genomic Location (Zv9):
Chromosome 19 (position 22657579)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22588959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTCATCAGTCTGGCCTGCTACCTCGCCTCCCTCGCCTTCCTCAAT[G/T]AATACTTTGGTAAGAACTGACAACACATTTGACATCTTCTAATTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link