atp9b

Ensembl ID:
ENSDARG00000062521
ZFIN ID:
ZDB-GENE-060503-583
Description:
probable phospholipid-transporting ATPase IIB [Source:RefSeq peptide;Acc:NP_001038619]
Human Orthologue:
ATP9B
Human Description:
ATPase, class II, type 9B [Source:HGNC Symbol;Acc:13541]
Mouse Orthologue:
Atp9b
Mouse Description:
ATPase, class II, type 9B Gene [Source:MGI Symbol;Acc:MGI:1354757]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23507 Nonsense Mutation detected in F1 DNA During 2014
sa8437 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090476 Nonsense 88 1125 3 29
ENSDART00000136294 Nonsense 49 1108 2 28
Genomic Location:
Chromosome 19 (position 22576421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGATGATCTTTTTTCCTCTCCGTGGTCTCTGTCACGCAGCTGTTGC[G/T]AATGTCTGGTTCACACATGTCGCAGAAAGAAGGAGCTGAAAGCTCGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090476 Nonsense 138 1125 4 29
ENSDART00000136294 Nonsense 99 1108 3 28
Genomic Location:
Chromosome 19 (position 22578576)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTNNTCTCTCTCTCTCTTTCTCTCTCTTTCTTTTCTTTTAGGTTCTTTA[C/A]CAGCAGTTTAAGTTCTTCCTCAACTTGTATTTTCTAGTAGTGGCCTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cmrbo0wz