abcc13

Ensembl ID:
ENSDARG00000062519
ZFIN ID:
ZDB-GENE-050517-26
Human Orthologues:
ABCC8, ABCC9
Human Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:60]
Mouse Orthologues:
Abcc8, Abcc9
Mouse Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1352630]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44146 Nonsense Mutation detected in F1 DNA During 2016
sa44145 Nonsense Mutation detected in F1 DNA During 2016
sa24505 Nonsense Available for shipment Available now
sa39452 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10993 Essential Splice Site Available for shipment Available now
sa17159 Essential Splice Site Available for shipment Available now
sa44144 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Nonsense 43 1182 1 29
ENSDART00000142813   None 305 None 9
Genomic Location:
Chromosome 24 (position 24670184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTTGCTCTGTGTTTGATCATGAGTGGGAAAAACAACAGAATAATTA[C/A]AAGGAGGTAACTTTAATGAAAACAGCACAAGCCAGAGAAATTGTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Nonsense 91 1182 2 29
ENSDART00000142813   None 305 None 9
Genomic Location:
Chromosome 24 (position 24669947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAGACATTTCATCCATCTTTAATCAAAATTGTGCTTCTGAGATTGT[C/G]ATCTGATCTTTTCAGTATTTTAGTTCCTATTACTATCAGGTATAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Nonsense 223 1182 4 29
ENSDART00000142813 Nonsense 18 305 1 9
Genomic Location:
Chromosome 24 (position 24668357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACTCTCTATCTGGGCTTACTTTGGGCTAAACTGGGTCCTAGTGTGT[T/A]GGTGGGAGTGACATTGCTACTAGTCCTCATCCCTGTCAAGTCAGCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Essential Splice Site 269 1182 5 29
ENSDART00000142813 Essential Splice Site 64 305 2 9
Genomic Location:
Chromosome 24 (position 24668119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGAAAAGAGTGAACAGCTCATCAAGGAAATGTTGCATAAATATCAG[G/A]TTATTTTAATTCCTAATCCTTACACTTGATCCTGTCATTTATAGTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Essential Splice Site 402 1182 9 29
ENSDART00000142813   None 305 None 9
ENSDART00000090514 Essential Splice Site 402 1182 9 29
ENSDART00000142813   None 305 None 9
Genomic Location:
Chromosome 24 (position 24664290)
KASP Assay ID:
2261-8757.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATATTGAAGGATGYACCAAGAAAGGGGTTTTATTTATTTGGTTAAG[T/C]GAATATGTTTGTCATTGTAAAACAGGGGCTACAGAAGAGTCTTCTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Essential Splice Site 402 1182 9 29
ENSDART00000142813   None 305 None 9
ENSDART00000090514 Essential Splice Site 402 1182 9 29
ENSDART00000142813   None 305 None 9
Genomic Location:
Chromosome 24 (position 24664290)
KASP Assay ID:
2261-8757.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATATTGAAGGAWGYACCAAGAAAGGGGTTTTATTTATTTGGTTAAG[T/C]GAATATGTTTGTCATTGTAAAACAGGGGCTACAGAAGAGTCTTCTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090514 Nonsense 610 1182 18 29
ENSDART00000142813   None 305 None 9
Genomic Location:
Chromosome 24 (position 24661597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATGGTAAAATGAAACAATTTATTTGTAAGTGAAAAAATCCTCTACT[T/G]AAAAGCAGTTGTTTGTGTTGTTTCAGGAGTTCAGGGAAGCCTGCTGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link