ulk1a

Ensembl ID:
ENSDARG00000062518
ZFIN ID:
ZDB-GENE-080723-31
Description:
unc-51-like kinase 1a [Source:RefSeq peptide;Acc:NP_001124103]
Human Orthologue:
ULK1
Human Description:
unc-51-like kinase 1 (C. elegans) [Source:HGNC Symbol;Acc:12558]
Mouse Orthologue:
Ulk1
Mouse Description:
Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13161 Nonsense Available for shipment Available now
sa5503 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9810 Nonsense Available for shipment Available now
sa7155 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3654 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa25404 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Nonsense 226 927 9 28
ENSDART00000124641 Nonsense 231 1038 9 32
ENSDART00000142243 None None 558 None 14
ENSDART00000144239 Nonsense 226 271 9 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46378866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTTGATTTCTTTAGGCAAGTACTCCTCAGGAAYTRCGGCAGTTYTA[T/G]GAAAGAAACCGGAGCCTCAGTCCCAGGTAAGTGGCCCTGAGCACTGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Essential Splice Site 235 927 10 28
ENSDART00000124641 Essential Splice Site 240 1038 10 32
ENSDART00000142243 None None 558 None 14
ENSDART00000144239 Essential Splice Site 235 271 10 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46380689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTCTGAGTCTTTTCCGTGTTTAAATCGRCACAAAAATTCTTTTTCCA[G/A]TATTCCACGTGAAACTTCCAGTCACTTGAGGCACCTTCTGCTTGGGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Nonsense 461 927 17 28
ENSDART00000124641 Nonsense 487 1038 18 32
ENSDART00000142243 Nonsense 92 558 3 14
ENSDART00000144239 None None 271 None 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46387486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGGATCTCCAGCATGTGGGAGAACCGGTGTTTCTCCAGATTCAGGA[G/T]GATCCAGATCGTATTTACCTTCCCCACAGGGWAAAGAAACCAGTTCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Essential Splice Site 471 927 None 28
ENSDART00000124641 Essential Splice Site 497 1038 None 32
ENSDART00000142243 Essential Splice Site 102 558 None 14
ENSDART00000144239 None None 271 None 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46387518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTCCAGATTCAGGAGGATCCAGATCGTATTTACCTTCCCCACAGGG[T/A]AAAGAAACCAGTTCTTCGATGATCTGTTTATGTATTTGCATATTTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Splice Site, Nonsense 472 927 18 28
ENSDART00000124641 Nonsense 499 1038 19 32
ENSDART00000142243 Splice Site, Nonsense 103 558 4 14
ENSDART00000144239 None None 271 None 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46387985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGAYACCATGTGGATTCTAAACCTGTTTTTTTCTTTATTTTTTTAGTC[G/T]GAAGCATTCCTGAAACACCCAGTCAGCCTGAACCTGTTGGCAGCAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Essential Splice Site 772 927 25 28
ENSDART00000124641 Essential Splice Site 883 1038 29 32
ENSDART00000142243 Essential Splice Site 403 558 11 14
ENSDART00000144239 None None 271 None 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46394773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGATATAAATGTCAAGTACACTGTGGTGACCTGCGTGTGTGTGTGTA[G/A]TTCTGCAGAACAATTGGTTCTCTATATGAAATGTGCTGAGCTGCTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090534 Nonsense 888 927 27 28
ENSDART00000124641 Nonsense 999 1038 31 32
ENSDART00000142243 Nonsense 519 558 13 14
ENSDART00000144239 None None 271 None 11

The following transcripts of ENSDARG00000062518 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 46397112)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGATGTTTCATCAMGGAGAAAGCTCTCTAGAGAGATACCACAAGGCCT[T/G]ACTGCTRATGGAGGGCCTGTCCTTGATTATTACAGAGCCTTCAGACCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ugzszd80