ENSDARG00000062513

Ensembl ID:
ENSDARG00000062513

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4628 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19126 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090499 Essential Splice Site 734 918 18 22
ENSDART00000090499 Essential Splice Site 734 918 18 22
Genomic Location:
Chromosome 15 (position 44171637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGGTCTTCAGGATCTCAGGGCTGGATTTGCCACRCTGGAGTCTCAGG[T/G]CATCATGATTTCTCGATTTTGCTTCTGTCTGCAAAGCATCTCTGTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090499 Essential Splice Site 734 918 18 22
ENSDART00000090499 Essential Splice Site 734 918 18 22
Genomic Location:
Chromosome 15 (position 44171637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTCTTCAGGATCTCAGGGCTGGATTTGCCACACTGGAGTCTCAGG[T/G]CATCATGATTTCTCGATTTTGCTTCTGTCTGCAAAGCATCTCTGTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/81wvezka