golga3

Ensembl ID:
ENSDARG00000062511
ZFIN ID:
ZDB-GENE-060526-252
Description:
Golgin subfamily A member 3 [Source:RefSeq peptide;Acc:NP_001122017]
Human Orthologue:
GOLGA3
Human Description:
golgin A3 [Source:HGNC Symbol;Acc:4426]
Mouse Orthologue:
Golga3
Mouse Description:
golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI Symbol;Acc:MGI:96958]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12910 Nonsense Available for shipment Available now
sa20374 Nonsense Mutation detected in F1 DNA During 2014
sa20373 Nonsense Mutation detected in F1 DNA During 2014
sa14639 Nonsense Available for shipment Available now
sa15016 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090494 Nonsense 325 1494 4 24
ENSDART00000137022 Nonsense 325 1494 5 24
Genomic Location:
Chromosome 5 (position 20776728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGAATCAGGCTTCAGAGCTGACGGCAATGACAGCGATAGCTCATCCTA[T/A]AGTAGCGTGTCTACTACAGGAACGTATAATATGTTATCTGCAATAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090494 Nonsense 587 1494 7 24
ENSDART00000137022 Nonsense 587 1494 8 24
Genomic Location:
Chromosome 5 (position 20772296)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCTCGCAGGCAGAAGTGGACTCGTTGCAGCAGCTTCGCCTCTGGTA[C/G]CAGCAGCAGCTCAATCTGGCACAGGAGGCACGAGTGCGACTGCAGGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090494 Nonsense 971 1494 13 24
ENSDART00000137022 Nonsense 971 1494 14 24
Genomic Location:
Chromosome 5 (position 20764530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGCGGCAGTGACCGAAGAAAATGAAAATCTGAGGAAGAGGGTTGAA[C/T]AAATGCAAAATGAAGCCAGAACGTGAGTCACAATCGCACCGCCTCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090494 Nonsense 1255 1494 20 24
ENSDART00000137022 Nonsense 1255 1494 20 24
Genomic Location:
Chromosome 5 (position 20754779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGTTTTGTAMAATGTTTTTATTTTTCTCKCTGACAGAGCTCAAGAT[G/T]AGAAGCACTCAGAAGAGGTTTCTCGTTTCCGGGAGGAAYTAGCTGAYGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090494 Nonsense 1281 1494 20 24
ENSDART00000137022 Nonsense 1281 1494 20 24
Genomic Location:
Chromosome 5 (position 20754701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGGGAGGAAYTAGCTGAYGCTCACACYCAACTTCAGATCCTTCAAAAA[C/T]AGCTTGATGATGAGCTCAATAAACAGCCYSTCACTAACCAAGAGGTAYAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/krmtwef4