bcl11b

Ensembl ID:
ENSDARG00000062510
ZFIN ID:
ZDB-GENE-061207-62
Description:
Novel protein similar to vertebrate B-cell CLL/lymphoma 11B (Zinc finger protein) (BCL11B) [Source:U
Human Orthologue:
BCL11B
Human Description:
B-cell CLL/lymphoma 11B (zinc finger protein) [Source:HGNC Symbol;Acc:13222]
Mouse Orthologue:
Bcl11b
Mouse Description:
B-cell leukemia/lymphoma 11B Gene [Source:MGI Symbol;Acc:MGI:1929913]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2902 Nonsense F2 line generated During 2014
sa6468 Nonsense Mutation detected in F1 DNA During 2014
sa16831 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2902
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 500 662 3 3
ENSDART00000144894 Nonsense 633 795 2 2
Genomic Location:
Chromosome 17 (position 18005958)
KASP Assay ID:
554-2685.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATCCCGCCACTTCATCAAAGATCCTTTCCTTGGCTTCACCGACTCC[A/T]GACAATCTCCATTCGCCACCTCCTCGGAACACTCCTCCGAGAACGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 597 662 3 3
ENSDART00000144894 Nonsense 730 795 2 2
Genomic Location:
Chromosome 17 (position 18006251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCACAGACGCAGCCACACAGGCGAGAGGCCCTACAAGTGTGAGCTTTG[T/A]AACTACGCCTGCGCCCAGAGCAGCAAGCTCMCCCGCCACATGAAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 644 662 3 3
ENSDART00000144894 Nonsense 777 795 2 2
Genomic Location:
Chromosome 17 (position 18006392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCCCTTCAGCGTCTACAGCACGCTTGAGAAACACATGAAAAAGTG[G/A]CATGGGGAACATTTGATGACGAATGAGRTCAAAATTGAACAAGCAGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aortic stiffness: Common genetic variation in the 3'-BCL11B gene desert is associated with carotid-femoral pulse wave velocity and excess cardiovascular disease risk: the AortaGen Consortium. (View Study)
  • Corneal curvature: Genetic variants near PDGFRA are associated with corneal curvature in Australians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aqyqokd1