LOC555631

Ensembl ID:
ENSDARG00000062502
Human Orthologue:
C20orf54
Human Description:
chromosome 20 open reading frame 54 [Source:HGNC Symbol;Acc:16187]
Mouse Orthologue:
2310046K01Rik
Mouse Description:
RIKEN cDNA 2310046K01 gene Gene [Source:MGI Symbol;Acc:MGI:1916948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23508 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090464 Nonsense 222 445 1 3
Genomic Location:
Chromosome 19 (position 22806689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTTTTCTTCCTGACGGCTATGATGGTGGTTTGTCTGGTGGCGTTTT[T/A]ACTTTTAAACTACCATCCGGCTGTGGCTCGAGAACGGCCTAATGGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2xun69os