hhipl1

Ensembl ID:
ENSDARG00000062501
ZFIN ID:
ZDB-GENE-090306-3
Description:
LOC100002738 protein [Source:UniProtKB/TrEMBL;Acc:A4IG31]
Human Orthologue:
HHIPL1
Human Description:
HHIP-like 1 [Source:HGNC Symbol;Acc:19710]
Mouse Orthologue:
Hhipl1
Mouse Description:
hedgehog interacting protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17970 Nonsense Available for shipment Available now
sa23038 Nonsense Mutation detected in F1 DNA During 2014
sa19168 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Nonsense 174 820 2 9
Genomic Location:
Chromosome 17 (position 17776782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTATTGTCTGACGATCCACGTCTTGCAGAACTTGAGCATGACCAACGC[A/T]AGCTTTGTCAGTATTTAGAACTGGACGACCCAGATTACTGCTATCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Nonsense 251 820 2 9
Genomic Location:
Chromosome 17 (position 17776549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACACACAGGTTTTTTGTTGCCGAACAAGTTGGCCTGGTCTGGGTGTA[C/G]CTTCCAGATCAATCAAAGCTTGAAAAGCCCTTTCTAAACATCACAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Essential Splice Site 580 820 6 9
Genomic Location:
Chromosome 17 (position 17772495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAATAATTACTATCCATACATCATATCCTTTGCAGAGGATGAGGCAGG[T/G]ATGTATCCAGATTATCTATACAATTGCACTTTTTAAATGCTGCATGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/grqcmwfv