hhipl1

Ensembl ID:
ENSDARG00000062501
ZFIN ID:
ZDB-GENE-090306-3
Description:
LOC100002738 protein [Source:UniProtKB/TrEMBL;Acc:A4IG31]
Human Orthologue:
HHIPL1
Human Description:
HHIP-like 1 [Source:HGNC Symbol;Acc:19710]
Mouse Orthologue:
Hhipl1
Mouse Description:
hedgehog interacting protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17970 Nonsense Available for shipment Available now
sa23038 Nonsense Available for shipment Available now
sa36374 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Nonsense 174 820 2 9
Genomic Location (Zv9):
Chromosome 17 (position 17776782)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17926793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTATTGTCTGACGATCCACGTCTTGCAGAACTTGAGCATGACCAACGC[A/T]AGCTTTGTCAGTATTTAGAACTGGACGACCCAGATTACTGCTATCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Nonsense 251 820 2 9
Genomic Location (Zv9):
Chromosome 17 (position 17776549)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17926560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACACACAGGTTTTTTGTTGCCGAACAAGTTGGCCTGGTCTGGGTGTA[C/G]CTTCCAGATCAATCAAAGCTTGAAAAGCCCTTTCTAAACATCACAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090447 Nonsense 470 820 4 9
Genomic Location (Zv9):
Chromosome 17 (position 17774919)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17924930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGTATGAGGAGGTGGACATTGTGGAGAAGGGCCGGAATTATGGTTGG[A/T]GAGCAAAAGAAGGCTTCTCTTGTTATGACAAAAAACTTTGCGCCAACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link