dock11

Ensembl ID:
ENSDARG00000062485
ZFIN ID:
ZDB-GENE-060503-196
Description:
Novel protein similar to vertebrate dedicator of cytokinesis 9 (DOCK9) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
DOCK11
Human Description:
dedicator of cytokinesis 11 [Source:HGNC Symbol;Acc:23483]
Mouse Orthologue:
Dock11
Mouse Description:
dedicator of cytokinesis 11 Gene [Source:MGI Symbol;Acc:MGI:1923224]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26923 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13474 Essential Splice Site Available for shipment Available now
sa7593 Missense Mutation detected in F1 DNA During 2017
sa14188 Essential Splice Site Available for shipment Available now
sa13398 Nonsense Available for shipment Available now
sa38601 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Essential Splice Site 291 2075 9 57
ENSDART00000137575   None 982 None 24
Genomic Location (Zv9):
Chromosome 7 (position 20512255)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19048886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATGGAGGACCGGAGGAATGGCTCAGAAACGTCTGAAGGGTCTCTGGG[T/A]AAATAATGCACACACACACACTGAAAACATGAGCACACATGATCATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Essential Splice Site 345 2075 11 57
ENSDART00000137575   None 982 None 24
Genomic Location (Zv9):
Chromosome 7 (position 20503306)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19039937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAATGAGGGCCGACAGAAGATCTTCTCCCTCGATCCTGAGGTGCAGG[T/C]TAGTCAATTTYTCCCAATTATCACCTTCTGCATTACAAAGCGGAAAGCAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Missense 1155 2075 32 57
ENSDART00000137575 Missense 82 982 2 24
Genomic Location (Zv9):
Chromosome 7 (position 20462498)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18999129
KASP Assay ID:
554-4019.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCCAGAGATYAGACAGYTGGCTGTGGCTGTGCTKAAAAATCTCAWGA[T/A]CAAACACGCCATGGATGACCGGTACAATGCCTTTAAGGTAAGGTATGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Essential Splice Site 1658 2075 47 57
ENSDART00000137575 Essential Splice Site 576 982 15 24
Genomic Location (Zv9):
Chromosome 7 (position 20422404)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18959035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAATGTTCATGTTGCCGCTTTAATGGCAGAGTATTTGCACAGGAAAA[G/A]TAAGTTTGCAAAGATTCTTTACAGTCAACAGTAGTTTCATGCTCACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Nonsense 1728 2075 49 57
ENSDART00000137575 Nonsense 646 982 17 24
Genomic Location (Zv9):
Chromosome 7 (position 20418478)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18955109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGKTTTGAGCTCATAACACACATCGCCAGACTCATCAYTCCGGTWTA[T/G]GAAAAGCGACACGAGTTTGAGGTAAGAGAGAATGAAGGGGTRGYGCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090406 Nonsense 1740 2075 50 57
ENSDART00000137575 Nonsense 658 982 18 24
Genomic Location (Zv9):
Chromosome 7 (position 20412336)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18948967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCTCACACACTCTTTCTGTCTCGGTCCTGTAGAAACTGAGGCGAT[T/A]GTACGACACACTGCAGCGAGCTTATGCAAAGATATTGGAGGTGATGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link