lyve1

Ensembl ID:
ENSDARG00000062483
ZFIN ID:
ZDB-GENE-030131-9516
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQB0]
Human Orthologue:
LYVE1
Human Description:
lymphatic vessel endothelial hyaluronan receptor 1 [Source:HGNC Symbol;Acc:14687]
Mouse Orthologue:
Lyve1
Mouse Description:
lymphatic vessel endothelial hyaluronan receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2136348]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5794 Essential Splice Site F2 line generated During 2014
sa2963 Essential Splice Site F2 line generated During 2014
sa2974 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5794
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090420 Essential Splice Site 164 191 4 5
ENSDART00000133490 None None 271 None 4
ENSDART00000090420 Essential Splice Site 164 191 4 5
ENSDART00000133490 None None 271 None 4
Genomic Location:
Chromosome 18 (position 16406634)
KASP Assay ID:
554-2904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGAATYACTTAATGSATTACTTTTACCACTATTTTGTTATTTTCTT[A/T]TATATTTCAGCTGCTTCCWAAACATTTGTCATCAKTTCTGTTGTGCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2963
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090420 Essential Splice Site 164 191 4 5
ENSDART00000133490 None None 271 None 4
ENSDART00000090420 Essential Splice Site 164 191 4 5
ENSDART00000133490 None None 271 None 4
Genomic Location:
Chromosome 18 (position 16406634)
KASP Assay ID:
554-2904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGAATYACTTAATGSATTACTTTTACCACTATTTTGTTATTTTCTT[A/T]TATATTTCAGCTGCTTCCWAAACATTTGTCATCAKTTCTGTTGTGCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2974
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090420 Nonsense 170 191 4 5
ENSDART00000133490 None None 271 None 4
Genomic Location:
Chromosome 18 (position 16406653)
KASP Assay ID:
554-3157.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACTTTTACCACTATTTTGTTATTTTCTTWTATATTTCAGCTGCTTCC[A/T]AAACATTTGTCATCAKTTCTGTTGTGCTACTACTTTTGGTGGCAGCAGCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fuyccxqd