mlphb

Ensembl ID:
ENSDARG00000062481
ZFIN ID:
ZDB-GENE-070803-2
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JI93]
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41417 Nonsense Mutation detected in F1 DNA During 2016
sa14687 Essential Splice Site Available for shipment Available now
sa41418 Nonsense Mutation detected in F1 DNA During 2016
sa41419 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21486 Nonsense Mutation detected in F1 DNA During 2016
sa30918 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10656 Nonsense Available for shipment Available now
sa25426 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 65 579 2 13
ENSDART00000139725   None 135 None 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 25046075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAGACTAAAATTATGAAAGAGGACAACAAGAGAGAGCTGCTGGAATA[T/A]CAGCCTAAACTCAGTGATTCACTCTGCATTCGCTGTCTCCAACCCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 182 579 4 13
ENSDART00000139725   None 135 None 4
Genomic Location:
Chromosome 9 (position 25049463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACAGAGCCTCGAGACGATGACACGCACAGCATGCCTGAAGTTCACAG[T/C]GAGTAAAACAAAGTCCCATTCCTTTGTGATAWCAGACAATATTAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 286 579 7 13
ENSDART00000139725   None 135 None 4
Genomic Location:
Chromosome 9 (position 25052484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAATGAGATTAAGGATATAATGCATATCAGCCAAAAGAGTCTGGAC[A/T]AAGCCTCTCATTTTGGTAAGATCTGCTCTCTGCATTTATTTCCTTTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 291 579 7 13
ENSDART00000139725   None 135 None 4
Genomic Location:
Chromosome 9 (position 25052501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATAATGCATATCAGCCAAAAGAGTCTGGACAAAGCCTCTCATTTTGG[T/G]AAGATCTGCTCTCTGCATTTATTTCCTTTACCAACACTTAAAGAAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 396 579 9 13
ENSDART00000139725   None 135 None 4
Genomic Location:
Chromosome 9 (position 25053289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCTGAGCCGTTTGGAGCAGAAAATGACTTTGCCAATAATTGGGGGAT[C/A]AGTTGAACAGGTAAGTTAAACAGTTGTGCTGCCTAATATTTCTGTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 399 579 9 13
ENSDART00000139725   None 135 None 4
Genomic Location:
Chromosome 9 (position 25053300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGAGCAGAAAATGACTTTGCCAATAATTGGGGGATCAGTTGAACAG[G/A]TAAGTTAAACAGTTGTGCTGCCTAATATTTCTGTAAAAAAAAAAAACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 487 579 11 13
ENSDART00000139725 Nonsense 43 135 2 4
Genomic Location:
Chromosome 9 (position 25054356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTCAATTGTATACTCCAGAAARCAAAGCCGAATGCACACAAATCAT[T/A]AAAAAAGCAGAAGAGGGTGAGTTCCTTTGAGTTTAGTAACACAACTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 532 579 12 13
ENSDART00000139725 Nonsense 88 135 3 4
Genomic Location:
Chromosome 9 (position 25055267)
KASP Assay ID:
554-7344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGTTCATGGTTACTGTTTGCTTTATGTGAAGGTTACAGACATTCAG[A/T]AACGAATCGCTGCTTTGAGTGCAGCAGGGATGACAGTGGAGACATCCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link