si:dkey-21k24.4

Ensembl ID:
ENSDARG00000062477
ZFIN ID:
ZDB-GENE-061207-55
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BG06]
Human Orthologue:
C11orf41
Human Description:
chromosome 11 open reading frame 41 [Source:HGNC Symbol;Acc:24836]
Mouse Orthologue:
D430041D05Rik
Mouse Description:
RIKEN cDNA D430041D05 gene Gene [Source:MGI Symbol;Acc:MGI:2181743]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15271 Splice Site, Nonsense Available for shipment Available now
sa38030 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090397 Splice Site, Nonsense 178 1319 3 23
ENSDART00000143141   None 899 None 19
Genomic Location (Zv9):
Chromosome 25 (position 15765582)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15312126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCCTCAATCTCACTCCCCTCACRYAAAACCTTCTCTGCTTTYAGAC[G/T]AGACTCTTAGYGAATTCCCCAGGAACCCTGATCTACCCACTGCCCCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090397 Essential Splice Site 492 1319 5 23
ENSDART00000143141 Essential Splice Site 86 899 2 19
Genomic Location (Zv9):
Chromosome 25 (position 15781693)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15328237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCTTCATGGCTACCCACCCTCGGCATCCACTTGCAGCTCAAAACAG[G/A]TGAGACTCTTTTCCATCTGTCTTTTTTTTTTCTTTTTTTGATATTGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090397 Nonsense 1294 1319 21 23
ENSDART00000143141 Nonsense 876 899 17 19
Genomic Location (Zv9):
Chromosome 25 (position 15835238)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15381782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTCCTCTCTCCACCGTCCTCGTACCGCAGCCCGTCCTGGATGTCCTA[C/A]CCTCCAGAACCAGAGGACCTTCCGCACCAGTGGAACGACACAGTAAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link