si:dkey-21k24.2

Ensembl ID:
ENSDARG00000062469
ZFIN ID:
ZDB-GENE-061207-54
Description:
si:dkey-21k24.2 [Source:RefSeq peptide;Acc:NP_001137519]
Human Orthologue:
HIPK3
Human Description:
homeodomain interacting protein kinase 3 [Source:HGNC Symbol;Acc:4915]
Mouse Orthologue:
Hipk3
Mouse Description:
homeodomain interacting protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1314882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14832 Nonsense Mutation detected in F1 DNA During 2017
sa6801 Nonsense Mutation detected in F1 DNA During 2017
sa17399 Essential Splice Site Available for shipment Available now
sa17006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
Genomic Location (Zv9):
Chromosome 25 (position 15650155)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15196699
KASP Assay ID:
554-5061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACAAATGAGATTGTGGCAGTAAAGATAKTAAAGAACCACCCCTCGTA[T/A]GCCCGCCAGGGTCAAATAGAGGTCAGCATCTTGGCCAGACTRAGTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
Genomic Location (Zv9):
Chromosome 25 (position 15650155)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15196699
KASP Assay ID:
554-5061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACAAATGAGATTGTGGCAGTAAAGATAKTAAAGAACCACCCCTCGTA[T/A]GCCCGCCAGGGTCAAATAGAGGTCAGCATCTTGGCCAGACTRAGTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Essential Splice Site 574 1229 5 15
ENSDART00000147572 Essential Splice Site 574 1229 6 16
Genomic Location (Zv9):
Chromosome 25 (position 15692671)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15239215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWCCTTTTGTCACTATGCAGCACCTGATGGATTTCCCCCATTGCAACCAG[T/A]ATGTCCAMACATTTATAGTGACTTTTTYAAARTGTCTTRCGTGTTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 828 1229 11 15
ENSDART00000147572 Nonsense 828 1229 12 16
Genomic Location (Zv9):
Chromosome 25 (position 15698236)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15244780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGGACAYGCAGCCCTCAGTGTGTCCATCACCAAAGATGCCGGAAATGT[T/A]GCCGAGTGTGGAGCCGCAAACTAGCTCTCCWGAAAGAGCAGTGCAGGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link