pgap1

Ensembl ID:
ENSDARG00000062465
ZFIN ID:
ZDB-GENE-090313-216
Human Orthologue:
PGAP1
Human Description:
post-GPI attachment to proteins 1 [Source:HGNC Symbol;Acc:25712]
Mouse Orthologue:
Pgap1
Mouse Description:
post-GPI attachment to proteins 1 Gene [Source:MGI Symbol;Acc:MGI:2443342]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14116 Essential Splice Site Available for shipment Available now
sa34641 Nonsense Mutation detected in F1 DNA During 2017
sa21488 Splice Site, Nonsense Available for shipment Available now
sa21489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090346   49 943 None 27
ENSDART00000132045 Essential Splice Site 44 952 None 26
Genomic Location (Zv9):
Chromosome 9 (position 25159701)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24315487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAACCGATGCAGCATGACATACATGTTCGAGTACCCAGAATATCGAG[T/A]GAGTATCAGCGCTAACAGNNTCCATCGCCGTTGTTTTCTTCTCACGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090346 Nonsense 623 943 20 27
ENSDART00000132045 Nonsense 630 952 20 26
Genomic Location (Zv9):
Chromosome 9 (position 25170223)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24326009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCACTTCTCCTGATGATCAGAGTCCAGCTGAGCTCTGTCAGAAGAT[C/A]AGGACGTCCTGTCGAATTGCAAGAGGCCATGAGTAAATCCTTAGAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090346 Splice Site, Nonsense 655 943 21 27
ENSDART00000132045 Splice Site, Nonsense 662 952 21 26
Genomic Location (Zv9):
Chromosome 9 (position 25172659)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24328445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTAAATAAATGTCTAATCGTTTAAATTGATTTTCTTTCTACCACAGG[C/T]AAAGCTGGTTTCAGGATGTCTGGACATCTTTGGGCCTCCCTGGGGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090346 Nonsense 785 943 23 27
ENSDART00000132045   None 952 None 26
Genomic Location (Zv9):
Chromosome 9 (position 25175485)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24331271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAATTACCAACTTTTTAATATATACACTTAACTATGTCTTTCGACT[T/A]AGCTAAGGGCAGAGCTTTATAATCACAGTGTCTTCACATTGAATTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link