sgk3

Ensembl ID:
ENSDARG00000062460
ZFIN ID:
ZDB-GENE-070424-62
Description:
serine/threonine-protein kinase Sgk3 [Source:RefSeq peptide;Acc:NP_001103937]
Human Orthologue:
SGK3
Human Description:
serum/glucocorticoid regulated kinase family, member 3 [Source:HGNC Symbol;Acc:10812]
Mouse Orthologue:
Sgk3
Mouse Description:
serum/glucocorticoid regulated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2182368]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24502 Nonsense Available for shipment Available now
sa37892 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37891 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090368 Nonsense 52 486 3 17
Genomic Location (Zv9):
Chromosome 24 (position 24385791)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23632669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCATGAGTGGTTTGTGTTCCGGAGATATGCAGAATTTGACAAATTGTA[C/A]AACACGGTGAGTAAATGAATTTGTAAGTCCTTTGCATTTTTAGTCCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090368 Essential Splice Site 146 486 8 17
Genomic Location (Zv9):
Chromosome 24 (position 24377360)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23624238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAAATTACTTTTGCACATGCCTTCATGCTCATGTGTTTTTCCTTA[G/A]TGCAAAGCCCACTGACTTTGACTTTCTTAAAGTCATAGGAAAGGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090368 Nonsense 486 486 17 17
Genomic Location (Zv9):
Chromosome 24 (position 24367601)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23614479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGCCTTTCTGGGATTTTCTTACGCTCCGCCATCAGAAGATTCTTTCT[T/A]GTAAGGTTGGCGCTGCTAATGGCGATTTAAAGAGAGCTGCATAAAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link