las1l

Ensembl ID:
ENSDARG00000062457
ZFIN ID:
ZDB-GENE-030131-3625
Description:
hypothetical protein LOC561321 [Source:RefSeq peptide;Acc:NP_001119872]
Human Orthologue:
LAS1L
Human Description:
LAS1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:25726]
Mouse Orthologue:
Las1l
Mouse Description:
LAS1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923380]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090369 Nonsense 254 314 5 6
ENSDART00000121741 None None 189 None 5
ENSDART00000138606 Nonsense 475 580 11 13
Genomic Location:
Chromosome 5 (position 23904743)
KASP Assay ID:
554-0582.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACCACACCGCCAAAACAACGCAGATTCCGCCCACTGAGGAGCTCCAA[G/T]AGAAGYTGAGCACAGAAACTGTGCAGGAGAGGAACTYGGCTCTACAGGGA
Associated Phenotype:
Not determined
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
14:23142501-23143173 23143173 1 4.01 × 10-32 1.0 -5 ccng1 ENSDARG00000076667
25:34827000-34827200 34827000 -1 4.70 × 10-27 1.6 2 rps27.2 ENSDARG00000090186
1:28031101-28031527 28031527 1 3.11 × 10-26 -1.1 -6 cryaa ENSDARG00000053502
3:41780644-41781000 41780644 -1 4.15 × 10-16 -2.2 -1 grifin ENSDARG00000033382
4:5406301-5406700 5407050 1 7.77 × 10-15 -1.5 -2 si:dkey-14d8.6 ENSDARG00000045835

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/npc33rxv