NP_001036154.1

Ensembl ID:
ENSDARG00000062451
Description:
fukutin-related protein isoform 2 [Source:RefSeq peptide;Acc:NP_001036154]
Human Orthologue:
FKRP
Human Description:
fukutin related protein [Source:HGNC Symbol;Acc:17997]
Mouse Orthologue:
Fkrp
Mouse Description:
fukutin related protein Gene [Source:MGI Symbol;Acc:MGI:2447586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa295 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa295
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090356 Nonsense 169 536 3 3
Genomic Location (Zv9):
Chromosome 15 (position 11906393)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11796936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGAGTTTTCTTTGTTAGTTCCTGATGGTGTGGAGCTGGACCATGGT[C/T]GACAAGTTGAGCGTCTCATTCGGGAGCTGGAAGGGGAAGGTGGTGGGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link