hecw2a

Ensembl ID:
ENSDARG00000062447
ZFIN ID:
ZDB-GENE-090311-22
Human Orthologue:
HECW2
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 [Source:HGNC Symbol;Acc:29853]
Mouse Orthologue:
Hecw2
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:2685

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa614 Nonsense Available for shipment Available now
sa12065 Essential Splice Site Available for shipment Available now
sa7184 Nonsense Mutation detected in F1 DNA During 2014
sa21490 Nonsense Available for shipment Available now
sa7630 Missense Mutation detected in F1 DNA During 2014
sa21491 Nonsense Available for shipment Available now
sa15103 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 None None 1263 None 25
ENSDART00000137756 Nonsense 106 1411 2 29
Genomic Location:
Chromosome 9 (position 25196267)
KASP Assay ID:
554-0524.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTTCTAASAGTGTTAATGCAATGTGCTTTTTATCAGATGAAACCTG[T/A]CCATCAAATGTGTGGGACTGTAAGAACCGTGGGGTAAACGGCACACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Essential Splice Site 47 1263 1 25
ENSDART00000137756 Essential Splice Site 250 1411 5 29
Genomic Location:
Chromosome 9 (position 25199030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGATCCGGCATTACAACTAACACCACTAATCCTGTTTGGCATGGAGAG[G/A]TGACACACACATAATGACACTTACAGCATACACTTACTCTCTTATTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Nonsense 276 1263 4 25
ENSDART00000137756 Nonsense 479 1411 8 29
Genomic Location:
Chromosome 9 (position 25200476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTACAGAGGCCACGTTGTCAACATTTAACGGCATTCCAAGGTCTTA[T/A]CAAACACCCCCAAAAGCAGCAGCAAGAGGAGCTGTGTTTGATGGAGGCRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Nonsense 654 1263 10 25
ENSDART00000137756 Nonsense 802 1411 14 29
Genomic Location:
Chromosome 9 (position 25209605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTAACAGCTTCTTGTCATGATTTCTTGTTCACCTTCAGAGTGCCTA[T/A]CGGATGTTCACAAGTAACACGTGTCTGAAGCACATGATCAGTAAAGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Missense 690 1263 10 25
ENSDART00000137756 Missense 838 1411 14 29
Genomic Location:
Chromosome 9 (position 25209712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCAACACTTTGAGCGGTACCAGCACAACCGAGACCTGGTCAACTTCC[T/G]CAATCTGTTCTCCAAYAAGCAGCTGGAGCTTCCCCGGGGCTGGGAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Nonsense 787 1263 13 25
ENSDART00000137756 Nonsense 935 1411 17 29
Genomic Location:
Chromosome 9 (position 25211774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTACGCATCTGTGTTTTTCAGCCTATAATGATAAGATTGTTGCCTTTT[T/A]GCGACAACCCAACATTTTTGAGATCCTGCAAGAGAGACAGCCAGAACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092240 Nonsense 1234 1263 25 25
ENSDART00000137756 Nonsense 1382 1411 29 29
Genomic Location:
Chromosome 9 (position 25220485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTCATGTTTCTTTATATRTTTGTGTAGGGCTCACACCTGCTTTAAC[C/T]GACTGGATCTCCCTCCCTACCCCTCGTTCTCCATGCTCTATGAGAAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yfzk460f