C16orf73

Ensembl ID:
ENSDARG00000062442
Description:
chromosome 16 open reading frame 73 [Source:HGNC Symbol;Acc:28569]
Human Orthologue:
C16orf73
Human Description:
chromosome 16 open reading frame 73 [Source:HGNC Symbol;Acc:28569]
Mouse Orthologue:
4930528F23Rik
Mouse Description:
RIKEN cDNA 4930528F23 gene Gene [Source:MGI Symbol;Acc:MGI:1922428]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35258 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35259 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42008 Nonsense Mutation detected in F1 DNA During 2016
sa11776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089589 Essential Splice Site 87 467 4 13
Genomic Location (Zv9):
Chromosome 12 (position 19560155)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18412316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGTGTATTTAATTGACACGGTAAGCCAAAATAACGTCTTGTGTTTTA[G/A]TTGTAATTGAAAATCCCCTCGTTGTGACCAAGGACTATGAGAAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089589 Essential Splice Site 260 467 9 13
Genomic Location (Zv9):
Chromosome 12 (position 19564200)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18416361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAATACTTTAACATTAAAATCTTTCATTTTTTTGTTGATTACTTATA[G/A]ATACAGCAGAGGCAAACCAGCTGTACACATTTGTCAGGGAACTGTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089589 Nonsense 268 467 9 13
Genomic Location (Zv9):
Chromosome 12 (position 19564226)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18416387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTTTTTGTTGATTACTTATAGATACAGCAGAGGCAAACCAGCTGTA[C/A]ACATTTGTCAGGGAACTGTTACAATCTGGAGGACTGGATGACCAGGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089589 Nonsense 304 467 10 13
Genomic Location (Zv9):
Chromosome 12 (position 19566992)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18419153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTCTTTCCCCTCAGTGGATTCCATTAGAGACGTCATGACAGYAAGC[C/T]AACYTAAAACCAGAAGTCAAGAAAATGCAGATGCCATTCATTGCATCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link