C16orf73

Ensembl ID:
ENSDARG00000062442
Description:
chromosome 16 open reading frame 73 [Source:HGNC Symbol;Acc:28569]
Human Orthologue:
C16orf73
Human Description:
chromosome 16 open reading frame 73 [Source:HGNC Symbol;Acc:28569]
Mouse Orthologue:
4930528F23Rik
Mouse Description:
RIKEN cDNA 4930528F23 gene Gene [Source:MGI Symbol;Acc:MGI:1922428]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089589 Nonsense 304 467 10 13
Genomic Location:
Chromosome 12 (position 19566992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTCTTTCCCCTCAGTGGATTCCATTAGAGACGTCATGACAGYAAGC[C/T]AACYTAAAACCAGAAGTCAAGAAAATGCAGATGCCATTCATTGCATCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m0z8gqe5