gpd2

Ensembl ID:
ENSDARG00000062430
ZFIN ID:
ZDB-GENE-030131-4869
Description:
glycerol-3-phosphate dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001038813]
Human Orthologue:
GPD2
Human Description:
glycerol-3-phosphate dehydrogenase 2 (mitochondrial) [Source:HGNC Symbol;Acc:4456]
Mouse Orthologue:
Gpd2
Mouse Description:
glycerol phosphate dehydrogenase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:99778]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7579 Missense Mutation detected in F1 DNA During 2014
sa17515 Nonsense Available for shipment Available now
sa9425 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090266 Missense 99 536 4 13
ENSDART00000127495 Missense 99 729 3 16
ENSDART00000144028 Missense 99 726 4 17

The following transcripts of ENSDARG00000062430 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 12352540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTGTCTTTCTGCCCCCTCGTCCAGATCTGAAGACYGCCCTAGTAGAA[C/T]GCAGTGATTTTTCATCGGGCACCAGCAGCAGGAGCACCAAGCTCATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090266 Nonsense 439 536 11 13
ENSDART00000127495 Nonsense 442 729 10 16
ENSDART00000144028 Nonsense 439 726 11 17

The following transcripts of ENSDARG00000062430 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 12308267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGGTTTCATAGCACTCTGTTYACTGTAGGTGGGAAGTGGACMACCTA[T/G]CGTTCGATGGCTGAGGAGACACTTGATGCGGCCATAAARGCTCATARCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090266 Essential Splice Site 491 536 11 13
ENSDART00000127495 Essential Splice Site 494 729 10 16
ENSDART00000144028 Essential Splice Site 491 726 11 17

The following transcripts of ENSDARG00000062430 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 12308109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCACCCTGTATATACGCTTGGTTCAAGACTACGGGCTTGAAAACGAGG[T/A]GGRTTTTGAAGACTAACTACTTAGCATTCWGCCAGTCTGAGCTCTTTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m60sao21