si:ch211-117k11.1

Ensembl ID:
ENSDARG00000062427
ZFIN ID:
ZDB-GENE-070705-19
Description:
Novel protein similar to vertebrate chloride channel 2 (CLCN2) [Source:UniProtKB/TrEMBL;Acc:A5PMN6]
Human Orthologue:
CLCN2
Human Description:
chloride channel 2 [Source:HGNC Symbol;Acc:2020]
Mouse Orthologue:
Clcn2
Mouse Description:
chloride channel 2 Gene [Source:MGI Symbol;Acc:MGI:105061]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10011 Nonsense Available for shipment Available now
sa18405 Essential Splice Site Available for shipment Available now
sa32880 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090260 Nonsense 47 940 1 23
ENSDART00000145720 Nonsense 47 307 1 8

The following transcripts of ENSDARG00000062427 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16726297)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17315585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGTTCGCGGCCAGGCTCCAGAACTGCTGGAGTAYGAGAAAGACCCATG[T/A]GCCAAGTGTCAAGGTGGGTGTGCWGTATACATACACAGGCGCCAACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090260 Essential Splice Site 139 940 4 23
ENSDART00000145720 Essential Splice Site 139 307 4 8

The following transcripts of ENSDARG00000062427 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16778713)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17263169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGCTCTCAGATCTCTTTGTAACCCCCATTGGTCATTTCTWCCTCCA[G/T]GCTCTGGGATCCCAGAGATGAAGACCATCCTCCGAGGTGTGGTGCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090260 Nonsense 826 940 23 23
ENSDART00000145720   None 307 None 8

The following transcripts of ENSDARG00000062427 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16824488)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17217494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTCCTCCGCTGGCTAGTTTCCGGGACAGTGGCAACAGCAGCAGCGTCT[C/A]GGAGGTCACTGAGCTCCACAAGCTCTGGAGTCGCCACAAGAGCCTATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link