nfia

Ensembl ID:
ENSDARG00000062420
ZFIN ID:
ZDB-GENE-050208-501
Description:
nuclear factor 1 A-type [Source:RefSeq peptide;Acc:NP_001073431]
Human Orthologue:
NFIA
Human Description:
nuclear factor I/A [Source:HGNC Symbol;Acc:7784]
Mouse Orthologue:
Nfia
Mouse Description:
nuclear factor I/A Gene [Source:MGI Symbol;Acc:MGI:108056]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16768 Nonsense Available for shipment Available now
sa24138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063467 Nonsense 232 524 4 12
ENSDART00000090237 Nonsense 232 481 4 11
ENSDART00000090242 Nonsense 232 507 4 11
ENSDART00000138233 Nonsense 232 507 4 11
ENSDART00000138382   254 254 None 4
Genomic Location (Zv9):
Chromosome 22 (position 17121642)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16873400
KASP Assay ID:
2261-6671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCGTCACATCAGGTGTCTTCACCGTCTCTGAGCTAGTGCGAGTCTCA[C/T]AGAGTAAGATCTCCACATCTTATAATGATTATTCTTCCTKTTGGGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063467 Nonsense 367 524 8 12
ENSDART00000090237   None 481 None 11
ENSDART00000090242 Nonsense 350 507 7 11
ENSDART00000138233 Nonsense 350 507 7 11
ENSDART00000138382   None 254 None 4
Genomic Location (Zv9):
Chromosome 22 (position 17096610)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16848368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCCTTCGCAGACCGCTTCCCCCCGAACGGCATTCACACACCATCAT[C/T]GACCTGTCATTACAGGACCCAGAGGTGAGGTCCCAACACCCCACCCTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link